Prev. |  KEGG KO K03947 > 

RIKEN DNA Bank Human Resource - NDUFA3

Gene ID NCBI Gene 4696 |  KEGG hsa:4696
Gene Symbol NDUFA3
Protein Name NADH:ubiquinone oxidoreductase subunit A3
Synonyms B9|CI-B9
Ortholog resources KEGG ortholog (KEGG orthology K03947) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX055879 IRAK139L15 pCMV-SPORT6 BC061644 NM_004542 Full
HGY087860 IRAL019K20 pDNR-LIB BC011021 NM_004542 Full/var
HGY095031 IRAL037J15 pDNR-LIB BC022369 NM_004542 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE045151 W01A112O15 pENTR-TOPO IRAK139L15 BC061644 NM_004542  
HGE045157 W01A112O21 pENTR-TOPO IRAK139L15 BC061644 NM_004542  
HGE044838 W01A112B14 pENTR-TOPO IRAL037J15 BC022369 NM_004542  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042482 ARe06D10 pKA1U5 NM_004542.2  
GCCGCTGTCGCCGCCGCGGAGACAAAGATGGCTGCGAGAGTCGGCGCCTTCCTCAAGAAT
HKR181779 ARi54H11 pGCAP10 NM_004542.2  
GGCCGCTGTCGCCGCCGCGGAGACAAAGATGGCTGCGAGAGTCGGCGCCTTCCTCAAGAA
HKR248821 ARiS122A21 pGCAP10 NM_004542.2  
GGCCNCNGANACAAAGATGGCTGCGAGAGTCGGCGCCTTCCTCAAGAATGCCTGGGACAA
HKR367729 RBd19F09 pGCAP10 NM_004542.2  
GGCTGTCGCCCCCACGGACCTTGTATGGATGCGAGAGTCCGCTCCTTCCTCAAGAATGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl