Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01437

HP ID(1) HP01437
Gene ID(2) 7329
Gene Symbol finder UBE2I
Protein Name ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)
RefSeq NM_003345.3
Length of RefSeq (bp) 1221
Chromosome 16p13.3
Reference DDBJ accession
UniGene Hs.302903

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe04B11 pKA1U5 GGGAAGTCCCNCAGACAAAGGGCAAGCGCCGCCGCCGCCNCCCCGCTTCGGACCTCCACC
ARf02F12 pKA1U5 GGAACTCGCGGGAGCGTCACCGTCCTGCGACGCTTCAGAGGATCCTTAGGCCTCAGTGGT
ARiS020L09 pGCAP10 GGCGCGCGGAGCGGGCTCCGGAGGGAAGTCCCGAGACAAAGGGAAGCGCCGCCGCCGCCG
ARiS087P17 pGCAP10 GGCGCTGCGCGCGGAGCGGGCTCCGGAGGGAAGTCCCGAGACAAAGGGAAGCGCCGCCGC
RBb12C03 pKA1U5 GAGGGAAGTCCCGAGACAAAGGGAAGCGCCGCCGCCGCCGCCCCGCTCGGTCCTCCACCT
RBb41E12 pGCAP1 GGCGGGCTCCGGAGGGAAGTCCCGAGACAAAGGGAAGCGCCGCCGCCGCCGCCCCGCTCG
RBd20H07 pGCAP10 GGGAGCTGCTCTGGCTGCGCGCGGAGCGGGCTCCGGAGGGAAGTCCCGAGACAAAGGGAA
RBd39C08 pGCAP10 GGGCTGCGCGCGGAGCGGGCTCCGGAGGGAAGTCCCGAGACAAAGGGAAGCGCCGCCGCC
RBd93H07 pGCAP10 GGCGCGCGGAGCGGGCTCCGGAGGGAAGTCCCGAGACAAAGGGAAGCGCCGCCGCCGCCG
RBdS022M10 pGCAP10 GGCGGAGCGGGCTCCGGAGGGAAGTCCCGAGACAAAGGGAAGCGCCGCCGCCGCCGCCCC
RBdS110K16 pGCAP10 GNAAGGATCCTTNGGCCTCACTGGTCTTTGGCCCCCGGCCCCAGGACCTGACCCCAAGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl