Prev. |  KEGG KO K10577 > 

RIKEN DNA Bank Human Resource - UBE2I

Gene ID NCBI Gene 7329 |  KEGG hsa:7329
Gene Symbol UBE2I
Protein Name ubiquitin conjugating enzyme E2 I
Synonyms C358B7.1|P18|UBC9
Featured content NF-kappa B signaling pathway (human)
Ortholog resource in our bank

  UBE2I

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080431 IRAL001B07 pOTB7 BC000427 NM_194261 Full
HGY083657 IRAL009C09 pOTB7 BC004429 NM_194261 Full
HGY098802 IRAL047A02 pOTB7 BC051289 NM_194261 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR041635 ARe04B11 pKA1U5 NM_003345.3  
GGGAAGTCCCNCAGACAAAGGGCAAGCGCCGCCGCCGCCNCCCCGCTTCGGACCTCCACC
HKR080932 ARf02F12 pKA1U5 NM_003345.3  
GGAACTCGCGGGAGCGTCACCGTCCTGCGACGCTTCAGAGGATCCTTAGGCCTCAGTGGT
HKR208273 ARiS020L09 pGCAP10 NM_003345.3  
GGCGCGCGGAGCGGGCTCCGGAGGGAAGTCCCGAGACAAAGGGAAGCGCCGCCGCCGCCG
HKR235177 ARiS087P17 pGCAP10 NM_003345.3  
GGCGCTGCGCGCGGAGCGGGCTCCGGAGGGAAGTCCCGAGACAAAGGGAAGCGCCGCCGC
HKR324851 RBb12C03 pKA1U5 NM_003345.3  
GAGGGAAGTCCCGAGACAAAGGGAAGCGCCGCCGCCGCCGCCCCGCTCGGTCCTCCACCT
HKR336508 RBb41E12 pGCAP1 NM_003345.3  
GGCGGGCTCCGGAGGGAAGTCCCGAGACAAAGGGAAGCGCCGCCGCCGCCGCCCCGCTCG
HKR368175 RBd20H07 pGCAP10 NM_003345.3  
GGGAGCTGCTCTGGCTGCGCGCGGAGCGGGCTCCGGAGGGAAGTCCCGAGACAAAGGGAA
HKR375656 RBd39C08 pGCAP10 NM_003345.3  
GGGCTGCGCGCGGAGCGGGCTCCGGAGGGAAGTCCCGAGACAAAGGGAAGCGCCGCCGCC
HKR397375 RBd93H07 pGCAP10 NM_003345.3  
GGCGCGCGGAGCGGGCTCCGGAGGGAAGTCCCGAGACAAAGGGAAGCGCCGCCGCCGCCG
HKR409098 RBdS022M10 pGCAP10 NM_003345.3  
GGCGGAGCGGGCTCCGGAGGGAAGTCCCGAGACAAAGGGAAGCGCCGCCGCCGCCGCCCC
HKR444256 RBdS110K16 pGCAP10 NM_003345.3  
GNAAGGATCCTTNGGCCTCACTGGTCTTTGGCCCCCGGCCCCAGGACCTGACCCCAAGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl