Prev. | Human A to Z list > U > 

RIKEN DNA Bank Human Resource - UBE2I

Gene ID (NCBI) 7329
Gene Symbol UBE2I
Protein Name ubiquitin-conjugating enzyme E2I
Synonyms C358B7.1|P18|UBC9
Databases KEGG link 01 |  NCBI Gene link 01
Featured content NF-kappa B signaling pathway (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY080431 IRAL001B07 pOTB7 BC000427 NM_194261 Full
HGY083657 IRAL009C09 pOTB7 BC004429 NM_194261 Full
HGY098802 IRAL047A02 pOTB7 BC051289 NM_194261 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041635 ARe04B11 pKA1U5 NM_003345.3  
GGGAAGTCCCNCAGACAAAGGGCAAGCGCCGCCGCCGCCNCCCCGCTTCGGACCTCCACC
HKR080932 ARf02F12 pKA1U5 NM_003345.3  
GGAACTCGCGGGAGCGTCACCGTCCTGCGACGCTTCAGAGGATCCTTAGGCCTCAGTGGT
HKR208273 ARiS020L09 pGCAP10 NM_003345.3  
GGCGCGCGGAGCGGGCTCCGGAGGGAAGTCCCGAGACAAAGGGAAGCGCCGCCGCCGCCG
HKR235177 ARiS087P17 pGCAP10 NM_003345.3  
GGCGCTGCGCGCGGAGCGGGCTCCGGAGGGAAGTCCCGAGACAAAGGGAAGCGCCGCCGC
HKR324851 RBb12C03 pKA1U5 NM_003345.3  
GAGGGAAGTCCCGAGACAAAGGGAAGCGCCGCCGCCGCCGCCCCGCTCGGTCCTCCACCT
HKR368175 RBd20H07 pGCAP10 NM_003345.3  
GGGAGCTGCTCTGGCTGCGCGCGGAGCGGGCTCCGGAGGGAAGTCCCGAGACAAAGGGAA
HKR375656 RBd39C08 pGCAP10 NM_003345.3  
GGGCTGCGCGCGGAGCGGGCTCCGGAGGGAAGTCCCGAGACAAAGGGAAGCGCCGCCGCC
HKR336508 RBb41E12 pGCAP1 NM_003345.3  
GGCGGGCTCCGGAGGGAAGTCCCGAGACAAAGGGAAGCGCCGCCGCCGCCGCCCCGCTCG
HKR397375 RBd93H07 pGCAP10 NM_003345.3  
GGCGCGCGGAGCGGGCTCCGGAGGGAAGTCCCGAGACAAAGGGAAGCGCCGCCGCCGCCG
HKR409098 RBdS022M10 pGCAP10 NM_003345.3  
GGCGGAGCGGGCTCCGGAGGGAAGTCCCGAGACAAAGGGAAGCGCCGCCGCCGCCGCCCC
HKR444256 RBdS110K16 pGCAP10 NM_003345.3  
GNAAGGATCCTTNGGCCTCACTGGTCTTTGGCCCCCGGCCCCAGGACCTGACCCCAAGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.11.25

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl