Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01427

HP ID(1) HP01427
Gene ID(2) 5050
Gene Symbol finder PAFAH1B3
Protein Name platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit 29kDa
RefSeq NM_002573.2
Length of RefSeq (bp) 1021
Chromosome 19q13.1
Reference DDBJ accession
UniGene Hs.466831

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi07A05 pGCAP10 GAAGTGAAGGCTTCCGTCCCTGGAGAGGAGGCGGCGCCCTGTATCGGCCTTCGTCCTCCG
RBb34G12 pGCAP1 GTGCCGGGTGCGCGGCCTGGGAGTCAGCGGCCCGAGCGGGAAGCGCCGGGCGAGCCCACT
RBd07C01 pGCAP10 GGGAACACTCCCGGGCCGACCCGACTCGCTCATCCTGCAGGAGCTGCGGCGCCAAGATGA
RBd24G12 pGCAP10 GCCCGGGCCGACCCGACTCGCTCATCCTGCAGGAGCTGCGGCGCCAAGATGAGTGGAGAG
RBd66H04 pGCAP10 GACTGTGNGGCCGTCGTGGGGGAAGCGAAGGTTCCTGATTCCACCTACCTCCTAAGTGAA
RBdS014P11 pGCAP10 GACTGTGCGGCCGTCGTGGGGGAAGCGAAGGTTCCTGATTCCACCTACCTCCTAAGTGAA
RBdS075F05 pGCAP10 GGCCGACCCGACTCGCTCATCCTGCAGGAGCTGCGGCGCCAAGATGAGTGGAGAGGAGAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl