Prev. |  KEGG KO K16795 > 

RIKEN DNA Bank Human Resource - PAFAH1B3

Gene ID NCBI Gene 5050 |  KEGG hsa:5050
Gene Symbol PAFAH1B3
Protein Name platelet activating factor acetylhydrolase 1b catalytic subunit 3
Synonyms PAFAHG
Ortholog resources KEGG ortholog (KEGG orthology K16795) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083875 IRAL009L11 pOTB7 BC003016 NM_002573
HGY088308 IRAL020M20 pOTB7 BC007863 NM_002573 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR162805 ARi07A05 pGCAP10 NM_002573.2  
GAAGTGAAGGCTTCCGTCCCTGGAGAGGAGGCGGCGCCCTGTATCGGCCTTCGTCCTCCG
HKR333756 RBb34G12 pGCAP1 NM_002573.2  
GTGCCGGGTGCGCGGCCTGGGAGTCAGCGGCCCGAGCGGGAAGCGCCGGGCGAGCCCACT
HKR362849 RBd07C01 pGCAP10 NM_002573.2  
GGGAACACTCCCGGGCCGACCCGACTCGCTCATCCTGCAGGAGCTGCGGCGCCAAGATGA
HKR369756 RBd24G12 pGCAP10 NM_002573.2  
GCCCGGGCCGACCCGACTCGCTCATCCTGCAGGAGCTGCGGCGCCAAGATGAGTGGAGAG
HKR386572 RBd66H04 pGCAP10 NM_002573.2  
GACTGTGNGGCCGTCGTGGGGGAAGCGAAGGTTCCTGATTCCACCTACCTCCTAAGTGAA
HKR405971 RBdS014P11 pGCAP10 NM_002573.2  
GACTGTGCGGCCGTCGTGGGGGAAGCGAAGGTTCCTGATTCCACCTACCTCCTAAGTGAA
HKR430125 RBdS075F05 pGCAP10 NM_002573.2  
GGCCGACCCGACTCGCTCATCCTGCAGGAGCTGCGGCGCCAAGATGAGTGGAGAGGAGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl