Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01392

HP ID(1) HP01392
Gene ID(2) 57104
Gene Symbol finder PNPLA2
Protein Name patatin-like phospholipase domain containing 2
RefSeq NM_020376.2
Length of RefSeq (bp) 2113
Chromosome 11p15.5
Reference DDBJ accession
UniGene Hs.654697

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS085A14 pGCAP10 GGTAGCTTCTTCGCCTCCGCCAGCGGGGACCCCGAGCTAGAGCCGCAGCGGGACCTGCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl