Prev. |  KEGG KO K16816 > 

RIKEN DNA Bank Human Resource - PNPLA2

Gene ID NCBI Gene 57104 |  KEGG hsa:57104
Gene Symbol PNPLA2
Protein Name patatin like phospholipase domain containing 2
Synonyms 1110001C14Rik|ATGL|FP17548|PEDF-R|TTS-2.2|TTS2|iPLA2zeta
Ortholog resources KEGG ortholog (KEGG orthology K16816) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX004923 IRAK012F03 pCMV-SPORT6 BC011958 NM_020376 Partial/var
HGY095798 IRAL039I06 pOTB7 BC017280 NM_020376

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE100806 M01C052A06 pDONR221 MGC15-F03 BC017280 NM_020376  
HGE100854 M01C052C06 pDONR221 MGC15-F03 BC017280 NM_020376  
HGE100902 M01C052E06 pDONR221 MGC15-F03 BC017280 NM_020376  
HGE100950 M01C052G06 pDONR221 MGC15-F03 BC017280 NM_020376  
HGE100998 M01C052I06 pDONR221 MGC15-F03 BC017280 NM_020376  
HGE101046 M01C052K06 pDONR221 MGC15-F03 BC017280 NM_020376  
HGE101094 M01C052M06 pDONR221 MGC15-F03 BC017280 NM_020376  
HGE101142 M01C052O06 pDONR221 MGC15-F03 BC017280 NM_020376  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_210404.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR234014 ARiS085A14 pGCAP10 NM_020376.2  
GGTAGCTTCTTCGCCTCCGCCAGCGGGGACCCCGAGCTAGAGCCGCAGCGGGACCTGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.04.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl