Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01388

HP ID(1) HP01388
Gene ID(2) 10956
Gene Symbol finder OS9
Protein Name amplified in osteosarcoma
RefSeq NM_006812.2
Length of RefSeq (bp) 2721
Chromosome 12q13
Reference DDBJ accession
UniGene Hs.527861

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARf04H04 pKA1U5 GATAAGAAGGGGAACGAAAGATGGCGGCGGAAACGCTGCTGTCCAGTTTGTTAGGACTGC
ARiS087D15 pGCAP10 GGCATAAGAAGGGGAACGAAAGATGGCGGCGGAAACGCTGCTGTCCAGTTTGTTAGGACT
ARiS198E20 pGCAP10 CTGTTATGGACGCCACATCCAGCAATACCACATGGAAGATTCAGAGATCAAAGGTGAAGT
RBd82B03 pGCAP10 GATAAGAAGGGGAACGAAAGATGGCGGCGGAAACGCTGCTGTCCAGTTTGTTAGGACTGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl