Prev. |  KEGG KO K10088 > 

RIKEN DNA Bank Human Resource - OS9

Gene ID NCBI Gene 10956 |  KEGG hsa:10956
Gene Symbol OS9
Protein Name OS9 endoplasmic reticulum lectin
Synonyms ERLEC2|OS-9
Featured content Lectin - human
Ortholog resource in our bank

  OS9

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080770 IRAL001P10 pOTB7 BC000532 NM_001017956 Full
HGY080876 IRAL002D04 pOTB7 BC006506 NM_006812 Partial
HGY086923 IRAL017F03 pOTB7 BC023513 NM_001017956 Full
HGY088915 IRAL022E19 pOTB7 BC007254 NM_001017956 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR081772 ARf04H04 pKA1U5 NM_006812.2  
GATAAGAAGGGGAACGAAAGATGGCGGCGGAAACGCTGCTGTCCAGTTTGTTAGGACTGC
HKR234887 ARiS087D15 pGCAP10 NM_006812.2  
GGCATAAGAAGGGGAACGAAAGATGGCGGCGGAAACGCTGCTGTCCAGTTTGTTAGGACT
HKR279316 ARiS198E20 pGCAP10 NM_006812.2  
CTGTTATGGACGCCACATCCAGCAATACCACATGGAAGATTCAGAGATCAAAGGTGAAGT
HKR392827 RBd82B03 pGCAP10 NM_006812.2  
GATAAGAAGGGGAACGAAAGATGGCGGCGGAAACGCTGCTGTCCAGTTTGTTAGGACTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl