Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01335

HP ID(1) HP01335
Gene ID(2) 10921
Gene Symbol finder RNPS1
Protein Name RNA binding protein S1, serine-rich domain
RefSeq NM_006711.2
Length of RefSeq (bp) 2038
Chromosome 16p13.3
Reference DDBJ accession
UniGene Hs.355643

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe98G06 pKA1U5 GAGAGCGGCGCCGGCCTCGGCGGCTGAGGAAAGCAGGAGGAGGTGGCGGCGGCGGGAAGA
ARf06D11 pKA1U5 GAGAGCGGCGCCGGCCTCGGCGGCTGAGGAAAGCAGGAGGAGGTGGCGGCGGCGGGAAGA
ARf07B10 pKA1U5 GGGCGCCGGCCTCGGCGGCTGAGGAAAGCAGGANGANGTGGCGGCGGCGGGAAGATGCTG
ARi57G03 pGCAP10 GAGATCGGCGCCGGCCTCGGCGGCTGAAGAAAGCAGGAGGAGGTGGCGGCGGCGNGAAGA
ARiS049L22 pGCAP10 GGCCGGCCTCGGCGGCTGAGGAAAGCAGGAGGAGGTGGCGGCGGCGGGAAGATGCTGCTC
RBb66F09 pGCAP1 GGGCCTCGGCGGCTGAGGAAAGCAGGAGGAGGTGGCGGCGGCGGGAAGATGGCTCCTTCA
RBd05H10 pGCAP10 GGCCGGCCTCGGCGGCTGAGGAAAGCAGGAGGAGGTGGCGGCGGCGGGAAGATGCTGCTC
RBd09G09 pGCAP10 GGGCGGCTGAGGAAAGCAGGAGGAGGTGGCGGCGGCGGGAAGATGCTGCTCTTTGGCGTA
RBd24G11 pGCAP10 GAGAGCGGCGCCGGCCTCGGCGGCTGAGGAAAGCAGGAGGAGGTGGCGGCGGCGGGAAGA
RBd61D07 pGCAP10 TGAGAGCGGCGCCGGCCTCGGCGGCTGAGGAAAGCAGGAGGAGGTGGCGGCGGCGGGAAG
RBd76D02 pGCAP10 GAGAGCGGCGCCGGCCTCGGCGGCTGAGGAAAGCAGGAGGAGGTGGCGGCGGCGGGAAGA
RBdS014G12 pGCAP10 GAGAGCGGCGCCGGCCTCGGCGGCTGAGGAAAGCAGGAGGAGGTGGCGGCGGCGGGAAGA
RBdS051D01 pGCAP10 TTGGCCGGCCTCGGCGGCTGAGGAAAGCAGGAGGAGGTGGCGGCGGCGGGAAGATGCTGC
RBdS104A11 pGCAP10 GGGCTGAGGAAAGCAGGAGGAGGTGGCGGCGGCGGGAAGATGCTGCTCTTTGGCGTAAAT
RBdS132D01 pGCAP10 GGCGGCGCCGGCCTCGGCGGCTGAGGAAAGCAGGAGGAGGTGGCGGCGGCGGGAAGATGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl