Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01305

HP ID(1) HP01305
Gene ID(2) 975
Gene Symbol finder CD81
Protein Name CD81 molecule
RefSeq NM_004356.3
Length of RefSeq (bp) 1497
Chromosome 11p15.5
Reference DDBJ accession
UniGene Hs.54457

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe19G05 pKA1U5 GGGCCAGAGAGCGAGCGCGCAACGGCGGCGACCGCTNCGACCCCACCGCGCATCCTGCCA
ARe84B09 pKA1U5 GGGCCAGAGAGCGAGCGCGCAACGGCGGCGACGGCGGCGACCCCACCGCGCATCCTGCCA
ARe88G12 pKA1U5 TGGAGAGAGCGAGCGCGCAACGGCGGCGACGGCGGNGACCCCACCGCGCATCCTGCCAGG
ARi31D06 pGCAP10 CGGCCGGCCGATGAGAGAGCGAGCGCGCAACGGCGGCGACGGCGGCGACCCCACCGCGCA
ARi33F06 pGCAP10 GGCCAGAGAGCGAGCGCGCAACGGCGGCGACGGCGGCGACCCCACCGCGCATCCTGCCAG
ARi36D01 pGCAP10 CCGCCGGCCGATGAGAGAGCNAGCGCGCAACGGCGGCGACGGCGGCGACCCCACCGCGCA
ARi45F03 pGCAP10 GAGAGAGCGAGCGCGCAACGGCGGCGACGGCGGCGACCCCACCGCGCATCCTGCCAGGCC
ARi57B12 pGCAP10 GGGCCAGAGAGCGAGCGCGCAACGGCGGCGACGGCGGCGACCCCACCGCGCATCCTGCCA
ARi68E02 pGCAP10 GGCCAGAGAGCGAGCGCGCAACGGCGGCGACGGCGGCGACCCCACCGCGCATCCTGCCAG
ARiS049O10 pGCAP10 GAGANANNNAGCGCNCAACNGCGNCGACGGCGGCAACNCCACCGCGCATCCTGCCNGGCC
ARiS109O06 pGCAP10 GGGCCAGAGAGCGAGCGCGCAACGGCGGCGACGGCGGCGACCCCACCGCGCATCCTGCCA
ARiS191O08 pGCAP10 GGGNNNTNNANCGAGCGCGCAACGGCGGCNACGGCGGCGACCCCACCGCGCATCCTGCCA
RBdS110M12 pGCAP10 GAGAGAGCGAGCGCNCCNCGGCGGCNACGGCGGCNACCCCNCCGCGCNTCCTGCCNGGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl