DNA Bank Top |  KEGG KO K06508 > 

RIKEN DNA Bank Human Resource - CD81

Gene ID NCBI Gene 975 |  KEGG hsa:975
Gene Symbol CD81
Protein Name CD81 molecule
Synonyms CVID6|S5.7|TAPA1|TSPAN28
Featured content B cell receptor signaling pathway (human)

Link

Ortholog resource in our bank

  CD81


External database

human CD81

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB07604 pcDNA3.1(+)cs-hCD81    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083201 IRAL008A01 pOTB7 BC002978 NM_004356 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097609 M01C044A09 pDONR221 MGC11-E05 BC002978 NM_004356  
HGE097657 M01C044C09 pDONR221 MGC11-E05 BC002978 NM_004356  
HGE097705 M01C044E09 pDONR221 MGC11-E05 BC002978 NM_004356  
HGE097753 M01C044G09 pDONR221 MGC11-E05 BC002978 NM_004356  
HGE097801 M01C044I09 pDONR221 MGC11-E05 BC002978 NM_004356  
HGE097849 M01C044K09 pDONR221 MGC11-E05 BC002978 NM_004356  
HGE097897 M01C044M09 pDONR221 MGC11-E05 BC002978 NM_004356  
HGE097945 M01C044O09 pDONR221 MGC11-E05 BC002978 NM_004356  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR047749 ARe19G05 pKA1U5 NM_004356.3  
GGGCCAGAGAGCGAGCGCGCAACGGCGGCGACCGCTNCGACCCCACCGCGCATCCTGCCA
HKR073633 ARe84B09 pKA1U5 NM_004356.3  
GGGCCAGAGAGCGAGCGCGCAACGGCGGCGACGGCGGCGACCCCACCGCGCATCCTGCCA
HKR075356 ARe88G12 pKA1U5 NM_004356.3  
TGGAGAGAGCGAGCGCGCAACGGCGGCGACGGCGGNGACCCCACCGCGCATCCTGCCAGG
HKR172478 ARi31D06 pGCAP10 NM_004356.3  
CGGCCGGCCGATGAGAGAGCGAGCGCGCAACGGCGGCGACGGCGGCGACCCCACCGCGCA
HKR173326 ARi33F06 pGCAP10 NM_004356.3  
GGCCAGAGAGCGAGCGCGCAACGGCGGCGACGGCGGCGACCCCACCGCGCATCCTGCCAG
HKR174473 ARi36D01 pGCAP10 NM_004356.3  
CCGCCGGCCGATGAGAGAGCNAGCGCGCAACGGCGGCGACGGCGGCGACCCCACCGCGCA
HKR178123 ARi45F03 pGCAP10 NM_004356.3  
GAGAGAGCGAGCGCGCAACGGCGGCGACGGCGGCGACCCCACCGCGCATCCTGCCAGGCC
HKR182836 ARi57B12 pGCAP10 NM_004356.3  
GGGCCAGAGAGCGAGCGCGCAACGGCGGCGACGGCGGCGACCCCACCGCGCATCCTGCCA
HKR187298 ARi68E02 pGCAP10 NM_004356.3  
GGCCAGAGAGCGAGCGCGCAACGGCGGCGACGGCGGCGACCCCACCGCGCATCCTGCCAG
HKR219946 ARiS049O10 pGCAP10 NM_004356.3  
GAGANANNNAGCGCNCAACNGCGNCGACGGCGGCAACNCCACCGCGCATCCTGCCNGGCC
HKR243942 ARiS109O06 pGCAP10 NM_004356.3  
GGGCCAGAGAGCGAGCGCGCAACGGCGGCGACGGCGGCGACCCCACCGCGCATCCTGCCA
HKR276744 ARiS191O08 pGCAP10 NM_004356.3  
GGGNNNTNNANCGAGCGCGCAACGGCGGCNACGGCGGCGACCCCACCGCGCATCCTGCCA
HKR444300 RBdS110M12 pGCAP10 NM_004356.3  
GAGAGAGCGAGCGCNCCNCGGCGGCNACGGCGGCNACCCCNCCGCGCNTCCTGCCNGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2024.10.02

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl