Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01245

HP ID(1) HP01245
Gene ID(2) 5018
Gene Symbol finder OXA1L
Protein Name oxidase (cytochrome c) assembly 1-like
RefSeq NM_005015.3
Length of RefSeq (bp) 1737
Chromosome 14q11.2
Reference DDBJ accession
UniGene Hs.151134

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARf02B06 pKA1U5 GCTCTTCCGGGCAAAATGGCGATGGGACTAATGTGCGGACGCCGGGAGCTTCTGCGCTTG
ARi35D06 pGCAP10 GGCAAAATGGCGATGGGACTAATGTGCGGACGCCGGGAGCTTCTGCGCTTGCTACAGTCC
RBb29G12 pGCAP1 GCCTCTTCCGGGCAAAATGGCGATGGGACTAATGTGCGGACGCCGGGAGCTTCTGCGCTT
RBd29E06 pGCAP10 GCTCTTCCGGGCAAAATGGCGATGGGACTAATGTGCGGACGCCGGGAGCTTCTGCGCTTG
RBdS154A21 pGCAP10 TGCTCTTCCGGGCAAAATGGCGATGGGACTAATGTGCGGACGCCGGGAGCTTCTGCGCTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl