Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154A21

Clone ID RBdS154A21
HP ID HP01245
Gene ID 5018
Gene Symbol OXA1L
Protein Name oxidase (cytochrome c) assembly 1-like
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_005015.3
Length of RefSeq (bp) 1737
Chromosome 14q11.2
Reference DDBJ accession
UniGene Hs.151134
5'-terminal sequence TGCTCTTCCGGGCAAAATGGCGATGGGACTAATGTGCGGACGCCGGGAGCTTCTGCGCTT
2011.08.28