Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01241

HP ID(1) HP01241
Gene ID(2) 5204
Gene Symbol finder PFDN5
Protein Name prefoldin subunit 5
RefSeq NM_002624.3
Length of RefSeq (bp) 745
Chromosome 12q12
Reference DDBJ accession
UniGene Hs.655327

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe16B04 pKA1U5 GGTTAAGTCGGCCTTCCCAACATGGCGCAGTCTATTAACATCACGGAGCTGAATCTGCCG
ARe41E03 pKA1U5 GCTTCCCAACATGGCGCAGTCTATTAACATCACGGAGCTGAATCTGCCGCAGCTAGAAAT
ARe43G06 pKA1U5 GGTTAAGTCGGCCTTCCCAACATGGCGCAGTCTATTAACATCACGGAGCTGAATCTGCCG
ARe93E01 pKA1U5 GCTTCCCAACATGGCGCAGTCTATTAACATCACGGAGCTGAATCTGCCGCAGCTAGAAAT
ARe99F06 pKA1U5 GCTCTTCGTTAAGTCGGCCTTCCCAACATGGCGCAGTCTATTAACATCACGGAGCTGAAT
ARi21G03 pGCAP10 TGGCTTCCCAACATGGCGCAGTCTATTAACATCACGGAGCTGAATCTGCCGCAGCTAGAA
ARiS008E07 pGCAP10 GCTTCCCAACATGNCNCAGTCTATTAACATCACGGAGCTGAATCTGCCGCAGCTAGAAAT
ARiS020O13 pGCAP10 GTTCGTTAAGTCGGCCTTCCCAACATGGCGCAGTCTATTAACATCACGGAGCTGAATCTG
ARiS055I07 pGCAP10 GGCTCGCCGANAGACTTCCTCTTCNTNAANTCGGCCTTCCCAACATGGCGCAGTCTATNA
ARiS055O20 pGCAP10 GCTTCCCAACATGGCGCAGTCTATTAACATCACGGAGCTGAATCTGCCGCAGCTAGAAAT
ARiS085A09 pGCAP10 GCTTCCCAACATGGCGCAGTCTATTAACATCACGGAGCTGAATCTGCCGCAGCTAGAAAT
ARiS087N24 pGCAP10
ARiS118A21 pGCAP10 GGCTCGCCGAGAGACTTCCTCTTCGTTAAGTCGGCCTTCCCAACATGGCGCAGTCTATTA
ARiS118E09 pGCAP10 GNTCGTTANGTCGGCCTTCCCAACATGGCGCAGTCTATTAACATCACGGAGCTGAATCTG
ARiS150G09 pGCAP10 GGCTCGCCGAGAGACTTCCNCTTCGTTAAGTCGGCCTTCCCAACATGGCGCAGTCTATTA
RBb17D01 pKA1U5 GGCTCGCCGAGAGACTTCCTCTTCGTTAAGTCGGCCTTCCCAACATGGCGCAGTCTATTA
RBb31D07 pGCAP1 GGCTCGCCGAGAGACTTCCTCTTCGTTAAGTCGGCCTTCCCAACATGGCGCAGTCTATTA
RBb33C01 pGCAP1 GAGACTTCCTCTTCGTTAAGTCGGCCTTCCCAACATGGCGCAGTCTATTAACATCACGGA
RBd21C08 pGCAP10 GGCTCGCCGAGAGACTTCCTCTTCGTTAAGTCGGCCTTCCCAACATGGCGCAGTCTATTA
RBd24C10 pGCAP10 GCTCTTCGTTAAGTCGGCCTTCCCAACATGGCGCAGTCTATTAACATCACGGAGCTGAAT
RBd29G11 pGCAP10
RBd64B04 pGCAP10 GCTTCCCAACATGGCGCAGTCTATTAACATCACGGAGCTGAATCTGCCGCAGCTAGAAAT
RBdS015A16 pGCAP10 GGGCCTTCCCAACATGGCGCAGTCTATTAACATCACGGAGCTGAATCTGCCGCAGCTAGA
RBdS075H05 pGCAP10 GGGCCTTCCCAACATGGCGCAGTCTATTAACATCACGGAGCTGAATCTGCCGCAGCTAGA
RBdS075P03 pGCAP10 CGGCCGGCCGATGCTCTTCGTTAAGTCGGCCTTCCCAACATGGCGCAGTCTATTAACATC
RBdS083M01 pGCAP10 GCTTCCCAACATGGCGCAGTCTATTAACATCACGGAGCTGAATCTGCCGCAGCTAGAAAT
RBdS132B21 pGCAP10 GGCCTTCCCAACATGGCGCAGTCTATTAACATCACGGAGCTGAATCTGCCGCAGCTAGAA
RBdS132H08 pGCAP10 GGCCTTCCCAACATGGCGCAGTCTATTAACATCACGGAGCTGAATCTGCCGCAGCTAGAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl