Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - PFDN5

Gene ID (NCBI) 5204
Gene Symbol PFDN5
Protein Name prefoldin subunit 5
Synonyms MM-1|MM1|PFD5
Databases KEGG link 01 |  NCBI Gene link 01


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB01944 pcDNA3-F-MM-1 Human MM-1 cDNA

RDB_hum_160722.csv


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX001317 IRAK003E21 pCMV-SPORT6 BC003373 NM_002624 Full
HGY100702 IRAL051M14 pDNR-LIB BC062671 NM_002624 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR046428 ARe16B04 pKA1U5 NM_002624.3
GGTTAAGTCGGCCTTCCCAACATGGCGCAGTCTATTAACATCACGGAGCTGAATCTGCCG
HKR168547 ARi21G03 pGCAP10 NM_002624.3
TGGCTTCCCAACATGGCGCAGTCTATTAACATCACGGAGCTGAATCTGCCGCAGCTAGAA
HKR056499 ARe41E03 pKA1U5 NM_002624.3
GCTTCCCAACATGGCGCAGTCTATTAACATCACGGAGCTGAATCTGCCGCAGCTAGAAAT
HKR057350 ARe43G06 pKA1U5 NM_002624.3
GGTTAAGTCGGCCTTCCCAACATGGCGCAGTCTATTAACATCACGGAGCTGAATCTGCCG
HKR077297 ARe93E01 pKA1U5 NM_002624.3
GCTTCCCAACATGGCGCAGTCTATTAACATCACGGAGCTGAATCTGCCGCAGCTAGAAAT
HKR079726 ARe99F06 pKA1U5 NM_002624.3
GCTCTTCGTTAAGTCGGCCTTCCCAACATGGCGCAGTCTATTAACATCACGGAGCTGAAT
HKR203303 ARiS008E07 pGCAP10 NM_002624.3
GCTTCCCAACATGNCNCAGTCTATTAACATCACGGAGCTGAATCTGCCGCAGCTAGAAAT
HKR208349 ARiS020O13 pGCAP10 NM_002624.3
GTTCGTTAAGTCGGCCTTCCCAACATGGCGCAGTCTATTAACATCACGGAGCTGAATCTG
HKR222199 ARiS055I07 pGCAP10 NM_002624.3
GGCTCGCCGANAGACTTCCTCTTCNTNAANTCGGCCTTCCCAACATGGCGCAGTCTATNA
HKR222356 ARiS055O20 pGCAP10 NM_002624.3
GCTTCCCAACATGGCGCAGTCTATTAACATCACGGAGCTGAATCTGCCGCAGCTAGAAAT
HKR234009 ARiS085A09 pGCAP10 NM_002624.3
GCTTCCCAACATGGCGCAGTCTATTAACATCACGGAGCTGAATCTGCCGCAGCTAGAAAT
HKR235136 ARiS087N24 pGCAP10 NM_002624.3
HKR247221 ARiS118A21 pGCAP10 NM_002624.3
GGCTCGCCGAGAGACTTCCTCTTCGTTAAGTCGGCCTTCCCAACATGGCGCAGTCTATTA
HKR247305 ARiS118E09 pGCAP10 NM_002624.3
GNTCGTTANGTCGGCCTTCCCAACATGGCGCAGTCTATTAACATCACGGAGCTGAATCTG
HKR260153 ARiS150G09 pGCAP10 NM_002624.3
GGCTCGCCGAGAGACTTCCNCTTCGTTAAGTCGGCCTTCCCAACATGGCGCAGTCTATTA
HKR326873 RBb17D01 pKA1U5 NM_002624.3
GGCTCGCCGAGAGACTTCCTCTTCGTTAAGTCGGCCTTCCCAACATGGCGCAGTCTATTA
HKR368456 RBd21C08 pGCAP10 NM_002624.3
GGCTCGCCGAGAGACTTCCTCTTCGTTAAGTCGGCCTTCCCAACATGGCGCAGTCTATTA
HKR369658 RBd24C10 pGCAP10 NM_002624.3
GCTCTTCGTTAAGTCGGCCTTCCCAACATGGCGCAGTCTATTAACATCACGGAGCTGAAT
HKR371755 RBd29G11 pGCAP10 NM_002624.3
HKR332479 RBb31D07 pGCAP1 NM_002624.3
GGCTCGCCGAGAGACTTCCTCTTCGTTAAGTCGGCCTTCCCAACATGGCGCAGTCTATTA
HKR333249 RBb33C01 pGCAP1 NM_002624.3
GAGACTTCCTCTTCGTTAAGTCGGCCTTCCCAACATGGCGCAGTCTATTAACATCACGGA
HKR385628 RBd64B04 pGCAP10 NM_002624.3
GCTTCCCAACATGGCGCAGTCTATTAACATCACGGAGCTGAATCTGCCGCAGCTAGAAAT
HKR406016 RBdS015A16 pGCAP10 NM_002624.3
GGGCCTTCCCAACATGGCGCAGTCTATTAACATCACGGAGCTGAATCTGCCGCAGCTAGA
HKR430173 RBdS075H05 pGCAP10 NM_002624.3
GGGCCTTCCCAACATGGCGCAGTCTATTAACATCACGGAGCTGAATCTGCCGCAGCTAGA
HKR430363 RBdS075P03 pGCAP10 NM_002624.3
CGGCCGGCCGATGCTCTTCGTTAAGTCGGCCTTCCCAACATGGCGCAGTCTATTAACATC
HKR433489 RBdS083M01 pGCAP10 NM_002624.3
GCTTCCCAACATGGCGCAGTCTATTAACATCACGGAGCTGAATCTGCCGCAGCTAGAAAT
HKR452845 RBdS132B21 pGCAP10 NM_002624.3
GGCCTTCCCAACATGGCGCAGTCTATTAACATCACGGAGCTGAATCTGCCGCAGCTAGAA
HKR452976 RBdS132H08 pGCAP10 NM_002624.3
GGCCTTCCCAACATGGCGCAGTCTATTAACATCACGGAGCTGAATCTGCCGCAGCTAGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.10

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl