Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01232

HP ID(1) HP01232
Gene ID(2) 7360
Gene Symbol finder UGP2
Protein Name UDP-glucose pyrophosphorylase 2
RefSeq NM_006759.3
Length of RefSeq (bp) 2185
Chromosome 2p14-p13
Reference DDBJ accession
UniGene Hs.516217

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe32G09 pKA1U5 GCTTTTCCGGGAGTCTCCAGCTGGCCCTCATTTGTGTCCGGAGCTCAGGAGTTCCCAAAC
ARiS049H21 pGCAP10 GGGTGACTTTCAGCCTGCGAGCCTTCTTCCCGGGGCGCCATAAACGCCCCCAATTTCCCA
RBb61D08 pGCAP1 GGAAAGTAGGGGCTGTGGGTGTCGGGAGCCGGCTGACGGGTGGACAAGGGGGGGTTAGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl