Prev. |  KEGG KO K00963 > 

RIKEN DNA Bank Human Resource - UGP2

Gene ID NCBI Gene 7360 |  KEGG hsa:7360
Gene Symbol UGP2
Protein Name UDP-glucose pyrophosphorylase 2
Synonyms UDPG|UDPGP|UDPGP2|UGP1|UGPP1|UGPP2|pHC379
Ortholog resources KEGG ortholog (KEGG orthology K00963) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001473 IRAK003L09 pCMV-SPORT6 BC000173 NM_006759 Full
HGX037221 IRAK093A21 pCMV-SPORT6 BC047004 NM_006759 Full
HGY083308 IRAL008E12 pOTB7 BC002954 NM_001001521 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE042241 W01A105K01 pENTR-TOPO IRAK093A21 BC047004 NM_006759 done
HGE042247 W01A105K07 pENTR-TOPO IRAK093A21 BC047004 NM_006759  
HGE042251 W01A105K11 pENTR-TOPO IRAK093A21 BC047004 NM_006759  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR052953 ARe32G09 pKA1U5 NM_006759.3  
GCTTTTCCGGGAGTCTCCAGCTGGCCCTCATTTGTGTCCGGAGCTCAGGAGTTCCCAAAC
HKR219789 ARiS049H21 pGCAP10 NM_006759.3  
GGGTGACTTTCAGCCTGCGAGCCTTCTTCCCGGGGCGCCATAAACGCCCCCAATTTCCCA
HKR344480 RBb61D08 pGCAP1 NM_006759.3  
GGAAAGTAGGGGCTGTGGGTGTCGGGAGCCGGCTGACGGGTGGACAAGGGGGGGTTAGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl