Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01231

HP ID(1) HP01231
Gene ID(2) 2647
Gene Symbol finder BLOC1S1
Protein Name biogenesis of lysosome-related organelles complex-1, subunit 1
RefSeq NM_001487.2
Length of RefSeq (bp) 590
Chromosome 12q13-q14
Reference DDBJ accession
UniGene Hs.94672

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe89D04 pKA1U5 GGTTCCAGCTTCCGGAGCCGGAGGGGGCCCGGCGCTACCCAGCCCCCAGCCCGACGTGAC
ARi38A03 pGCAP10 GGGGAAGGAGCGACTCTGGAGGGAGGAGGGTGTGGGGAACCCCCCAGAGATGGGCTTCTT
RBd62E05 pGCAP10 GGGAGCCGGAGGGGGCCCGGCGTACCCAGCCCCCAGCCCGACGTGACCATGCTGTCCCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl