Prev. |  KEGG KO K20185 > 

RIKEN DNA Bank Human Resource - BLOC1S1

Gene ID NCBI Gene 2647 |  KEGG hsa:2647
Gene Symbol BLOC1S1
Protein Name biogenesis of lysosomal organelles complex 1 subunit 1
Synonyms BLOS1|BORCS1|GCN5L1|MICoA|RT14
Ortholog resources KEGG ortholog (KEGG orthology K20185) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY067216 IRAK168A16 pBluescriptR BC066340 NM_001487 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE089604 M01C024A04 pDONR221 MGC01-F02 BC066340 NM_001487  
HGE089652 M01C024C04 pDONR221 MGC01-F02 BC066340 NM_001487  
HGE089700 M01C024E04 pDONR221 MGC01-F02 BC066340 NM_001487  
HGE089748 M01C024G04 pDONR221 MGC01-F02 BC066340 NM_001487  
HGE089796 M01C024I04 pDONR221 MGC01-F02 BC066340 NM_001487  
HGE089844 M01C024K04 pDONR221 MGC01-F02 BC066340 NM_001487  
HGE089892 M01C024M04 pDONR221 MGC01-F02 BC066340 NM_001487  
HGE089940 M01C024O04 pDONR221 MGC01-F02 BC066340 NM_001487  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR075676 ARe89D04 pKA1U5 NM_001487.2  
GGTTCCAGCTTCCGGAGCCGGAGGGGGCCCGGCGCTACCCAGCCCCCAGCCCGACGTGAC
HKR175203 ARi38A03 pGCAP10 NM_001487.2  
GGGGAAGGAGCGACTCTGGAGGGAGGAGGGTGTGGGGAACCCCCCAGAGATGGGCTTCTT
HKR384901 RBd62E05 pGCAP10 NM_001487.2  
GGGAGCCGGAGGGGGCCCGGCGTACCCAGCCCCCAGCCCGACGTGACCATGCTGTCCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl