Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01209

HP ID(1) HP01209
Gene ID(2) 5217
Gene Symbol finder PFN2
Protein Name profilin 2
RefSeq NM_002628.4
Length of RefSeq (bp) 1795
Chromosome 3q25.1-q25.2
Reference DDBJ accession
UniGene Hs.91747

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe50D02 pKA1U5 GCCCGCGCCGCCGCCGCCCGCTACCGCCGCCGCCGCCGCTGCGCCTGCTGCTCCTCGCCG
ARe74C11 pKA1U5 GGCTGCGCCTGCTGCTCCTCGCCGTCCGCGCTGCAGTGCGAAGGGCTCGAAGATGGCCGG
ARe82H08 pKA1U5 GGCTCCTCGCCGTCCGCGCTGCAGTGCGAAGGGCTCGAAGATGGCCGGTTGGCAGAGCTA
ARiS008K19 pGCAP10 ATTACGGTGAGGACCAGTGGCGGCCGGTACCCTGGTCCCTGCACCGGAGCGGGGTGGCCG
ARiS096F11 pGCAP10 GACCGCCGCCGCCGCCGCTGCGCCTGCTGCTCCTCGCCGTCCGCGCTGCAGTGCGAAGGG
RBd05E05 pGCAP10 GGCTCCTCGCCGTCCGCGCTGCAGTGCGAAGGGCTCGAAGATGGCCGGTTGGCAGAGCTA
RBd57B03 pGCAP10 GGTCCGCGCTGCAGTGCGAAGGGCTCGAAGATGGCCGGTTGGCAGAGCTACGTGGATAAC
RBdS070M14 pGCAP10 GGCCCGCTACCGCCGCCGCCGCCGCTGCGCCTGCTGCTCCTCGCCGTCCGCGCTGCAGTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl