Prev. |  KEGG KO K05759 > 

RIKEN DNA Bank Human Resource - PFN2

Gene ID NCBI Gene 5217 |  KEGG hsa:5217
Gene Symbol PFN2
Protein Name profilin 2
Synonyms D3S1319E|PFL
Ortholog resources KEGG ortholog (KEGG orthology K05759) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04124 pAxCALNLhPFN2 (reverse) Shuttle vector to generate rAd harboring human PFN2
RDB04160 pAxCALNLhPFN2 (reverse) Shuttle vector to generate rAd harboring human PFN2
RDB03550 pAxCALNLhPFN2 (forward) Shuttle vector to generate rAd harboring human PFN2 (forward)
RDB03593 pAxCALNLhPFN2 (forward) Shuttle vector to generate rAd harboring human PFN2 (forward)
RDB05235 pAxCALNLhPFN2(forward) Shuttle vector to generate rAd expressing human PFN2

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY012912 IRAK032E16 pBluescriptR BC018049 NM_053024 Full/var
HGY030162 IRAK075G18 pBluescriptR BC043646 NM_053024 Full
HGY083263 IRAL008C15 pOTB7 BC002964 NM_053024 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR060074 ARe50D02 pKA1U5 NM_002628.4  
GCCCGCGCCGCCGCCGCCCGCTACCGCCGCCGCCGCCGCTGCGCCTGCTGCTCCTCGCCG
HKR069659 ARe74C11 pKA1U5 NM_002628.4  
GGCTGCGCCTGCTGCTCCTCGCCGTCCGCGCTGCAGTGCGAAGGGCTCGAAGATGGCCGG
HKR072976 ARe82H08 pKA1U5 NM_002628.4  
GGCTCCTCGCCGTCCGCGCTGCAGTGCGAAGGGCTCGAAGATGGCCGGTTGGCAGAGCTA
HKR203459 ARiS008K19 pGCAP10 NM_002628.4  
ATTACGGTGAGGACCAGTGGCGGCCGGTACCCTGGTCCCTGCACCGGAGCGGGGTGGCCG
HKR238531 ARiS096F11 pGCAP10 NM_002628.4  
GACCGCCGCCGCCGCCGCTGCGCCTGCTGCTCCTCGCCGTCCGCGCTGCAGTGCGAAGGG
HKR362101 RBd05E05 pGCAP10 NM_002628.4  
GGCTCCTCGCCGTCCGCGCTGCAGTGCGAAGGGCTCGAAGATGGCCGGTTGGCAGAGCTA
HKR382827 RBd57B03 pGCAP10 NM_002628.4  
GGTCCGCGCTGCAGTGCGAAGGGCTCGAAGATGGCCGGTTGGCAGAGCTACGTGGATAAC
HKR428302 RBdS070M14 pGCAP10 NM_002628.4  
GGCCCGCTACCGCCGCCGCCGCCGCTGCGCCTGCTGCTCCTCGCCGTCCGCGCTGCAGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl