DNA Bank Top |  KEGG KO K05759 > 

RIKEN DNA Bank Human Resource - PFN2

Gene ID NCBI Gene 5217 |  KEGG hsa:5217
Gene Symbol PFN2
Protein Name profilin 2
Synonyms D3S1319E|PFL

Link

Ortholog resource in our bank

  PFN2


External database

human PFN2

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB05235 pAxCALNLhPFN2(forward) Shuttle vector to generate rAd expressing human PFN2    
RDB04160 pAxCALNLhPFN2 (reverse) Shuttle vector to generate rAd harboring human PFN2    
RDB04124 pAxCALNLhPFN2 (reverse) Shuttle vector to generate rAd harboring human PFN2    
RDB03593 pAxCALNLhPFN2 (forward) Shuttle vector to generate rAd harboring human PFN2 (forward)    
RDB03550 pAxCALNLhPFN2 (forward) Shuttle vector to generate rAd harboring human PFN2 (forward)    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY030162 IRAK075G18 pBluescriptR BC043646 NM_053024 Full
HGY012912 IRAK032E16 pBluescriptR BC018049 NM_053024 Full/var
HGY083263 IRAL008C15 pOTB7 BC002964 NM_053024 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR060074 ARe50D02 pKA1U5 NM_002628.4  
GCCCGCGCCGCCGCCGCCCGCTACCGCCGCCGCCGCCGCTGCGCCTGCTGCTCCTCGCCG
HKR069659 ARe74C11 pKA1U5 NM_002628.4  
GGCTGCGCCTGCTGCTCCTCGCCGTCCGCGCTGCAGTGCGAAGGGCTCGAAGATGGCCGG
HKR072976 ARe82H08 pKA1U5 NM_002628.4  
GGCTCCTCGCCGTCCGCGCTGCAGTGCGAAGGGCTCGAAGATGGCCGGTTGGCAGAGCTA
HKR203459 ARiS008K19 pGCAP10 NM_002628.4  
ATTACGGTGAGGACCAGTGGCGGCCGGTACCCTGGTCCCTGCACCGGAGCGGGGTGGCCG
HKR238531 ARiS096F11 pGCAP10 NM_002628.4  
GACCGCCGCCGCCGCCGCTGCGCCTGCTGCTCCTCGCCGTCCGCGCTGCAGTGCGAAGGG
HKR362101 RBd05E05 pGCAP10 NM_002628.4  
GGCTCCTCGCCGTCCGCGCTGCAGTGCGAAGGGCTCGAAGATGGCCGGTTGGCAGAGCTA
HKR382827 RBd57B03 pGCAP10 NM_002628.4  
GGTCCGCGCTGCAGTGCGAAGGGCTCGAAGATGGCCGGTTGGCAGAGCTACGTGGATAAC
HKR428302 RBdS070M14 pGCAP10 NM_002628.4  
GGCCCGCTACCGCCGCCGCCGCCGCTGCGCCTGCTGCTCCTCGCCGTCCGCGCTGCAGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2024.09.27

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl