Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01191

HP ID(1) HP01191
Gene ID(2) 25798
Gene Symbol finder BRI3
Protein Name brain protein I3
RefSeq NM_015379.3
Length of RefSeq (bp) 798
Chromosome 7q21.3
Reference DDBJ accession
UniGene Hs.567438

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe05C01 pKA1U5 GAGAGGGGCCCGAGCCACCCGGNTCCGCCGCGTCCCCNCCGCCGCCGCCGCGTTCCCCCG
ARe40B04 pKA1U5 GGCCCCGCGCTCTGCCTCAGAGGGGCCCGAGCCACCCGGATCCGCCGCGGTCCCCGCCGC
ARe54A11 pKA1U5 GCCCCGCGTCTGCCTCAGAGGGGCCCGAGCCACCCGGTTCCGCCGCGTCCCCGCCGCCGC
ARe70B05 pKA1U5 GGCCGCGTCCCCGCCGCCGCCGCCGCGTCCCCCGCCGGGGCCGACCGAGCCGAGCCGGGC
ARe82F05 pKA1U5 GGCCCGCGGCTCGCGCCCGCCCCGCCCCGCCCCGCGTTCTGCCTCAGAGGGGCCCGAGCC
ARe92F04 pKA1U5 AGTGGCCGCCGCCGCGTCCCCCGCCGGGGCCGACCGAGCCGAGCCGGGCCGGAGCGGCGG
ARiS049G23 pGCAP10 GAGAGGGGCCCGAGCCACCCGGTCCGCCGCGTCCCCGCCGCCGCCGCCGCGTCCCCCGCC
ARiS096L16 pGCAP10 GACCCNNTCCGCCGCGTCCNCGCCGCCGCCGCCGCGTCCCCCGCCGGGGCCGACNGAGCC
RBb29H12 pGCAP1 GGCCCCGCCCCGCCCCGCGTCTGCCTCAGAGGGGCCCGAGNCACCCGGTCCGCCGCGTCC
RBd93A05 pGCAP10 GCTGCCTCAGAGGGGCCCGAGCCACCCGGTCCGCCGCGTCCCCGCCGCCGCCGCCGCGTC
RBdS007M05 pGCAP10 GGGAAGCCCGCGGCTCGCGCCCGCCCCGCCCCGCCCCNCGTCTGCCTCAGAGGGGCCCGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl