Prev. | 

RIKEN DNA Bank Human Resource - BRI3

Gene ID NCBI Gene 25798 |  KEGG hsa:25798
Gene Symbol BRI3
Protein Name brain protein I3
Synonyms I3
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY103440 IRAL058J24 pOTB7 BC071992
HGY096300 IRAL040M12 pOTB7 BC018737 NM_015379 Full/var
HGY100383 IRAL050P23 pOTB7 BC062370 NM_015379 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE037459 W01A093K19 pENTR-TOPO IRAL050P23 BC062370 NM_015379  
HGE037461 W01A093K21 pENTR-TOPO IRAL050P23 BC062370 NM_015379  
HGE037491 W01A093M03 pENTR-TOPO IRAL050P23 BC062370 NM_015379  
HGE037493 W01A093M05 pENTR-TOPO IRAL050P23 BC062370 NM_015379  
HGE045168 W01A112P08 pENTR-TOPO IRAL050P23 BC062370 NM_015379  
HGE045170 W01A112P10 pENTR-TOPO IRAL050P23 BC062370 NM_015379  
HGE045172 W01A112P12 pENTR-TOPO IRAL050P23 BC062370 NM_015379  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042049 ARe05C01 pKA1U5 NM_015379.3  
GAGAGGGGCCCGAGCCACCCGGNTCCGCCGCGTCCCCNCCGCCGCCGCCGCGTTCCCCCG
HKR056028 ARe40B04 pKA1U5 NM_015379.3  
GGCCCCGCGCTCTGCCTCAGAGGGGCCCGAGCCACCCGGATCCGCCGCGGTCCCCGCCGC
HKR061611 ARe54A11 pKA1U5 NM_015379.3  
GCCCCGCGTCTGCCTCAGAGGGGCCCGAGCCACCCGGTTCCGCCGCGTCCCCGCCGCCGC
HKR068029 ARe70B05 pKA1U5 NM_015379.3  
GGCCGCGTCCCCGCCGCCGCCGCCGCGTCCCCCGCCGGGGCCGACCGAGCCGAGCCGGGC
HKR072925 ARe82F05 pKA1U5 NM_015379.3  
GGCCCGCGGCTCGCGCCCGCCCCGCCCCGCCCCGCGTTCTGCCTCAGAGGGGCCCGAGCC
HKR076924 ARe92F04 pKA1U5 NM_015379.3  
AGTGGCCGCCGCCGCGTCCCCCGCCGGGGCCGACCGAGCCGAGCCGGGCCGGAGCGGCGG
HKR219767 ARiS049G23 pGCAP10 NM_015379.3  
GAGAGGGGCCCGAGCCACCCGGTCCGCCGCGTCCCCGCCGCCGCCGCCGCGTCCCCCGCC
HKR238680 ARiS096L16 pGCAP10 NM_015379.3  
GACCCNNTCCGCCGCGTCCNCGCCGCCGCCGCCGCGTCCCCCGCCGGGGCCGACNGAGCC
HKR331780 RBb29H12 pGCAP1 NM_015379.3  
GGCCCCGCCCCGCCCCGCGTCTGCCTCAGAGGGGCCCGAGNCACCCGGTCCGCCGCGTCC
HKR397205 RBd93A05 pGCAP10 NM_015379.3  
GCTGCCTCAGAGGGGCCCGAGCCACCCGGTCCGCCGCGTCCCCGCCGCCGCCGCCGCGTC
HKR403093 RBdS007M05 pGCAP10 NM_015379.3  
GGGAAGCCCGCGGCTCGCGCCCGCCCCGCCCCGCCCCNCGTCTGCCTCAGAGGGGCCCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.07.06

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl