Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01140

HP ID(1) HP01140
Gene ID(2) 29968
Gene Symbol finder PSAT1
Protein Name phosphoserine aminotransferase 1
RefSeq NM_021154.3
Length of RefSeq (bp) 2083
Chromosome 9q21.2
Reference DDBJ accession
UniGene Hs.494261

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS118M21 pGCAP10 GGCAGACTCTCNCCNCNNCGNCCAGGAACGCCAGCCGTTCACGCGTTCGGTCCTCCTTGG
RBb48A01 pGCAP1 GAGACTCTCACCGCAGCGGCCAGGAACGCCAGCCGTTCACGCGTTCGGTCCTCCTTGGCT
RBd34E05 pGCAP10 GAGACTCTCACCGCAGCGGCCAGGAACGCCAGCCGTTCACGCGTTCGGTCCTCCTTGGCT
RBd37C04 pGCAP10 GAGCCGTTCACGCGTTCGGTCCTCCTTGGCTGACTCACCGCCCTCGCCGCCGCACCATGG
RBdS014A14 pGCAP10 GCTCCTTGGCTGACTCACCGCCCTCGCCGCCGCACCATGGACGCCCCCAGGCAGGTGGTC
RBdS104L02 pGCAP10 GAGACTCTCACCGCACCGGCCAGGAACGCCAGCCGTTCACGCGTTCGGTCCTCCTTGGCT
RBdS110A23 pGCAP10 GAGACTCTCACCGCAGCGGCCAGGAACGCCAGCCGTTCACGCGTTCGGTCCTCCTTGGCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl