Prev. |  KEGG KO K00831 > 

RIKEN DNA Bank Human Resource - PSAT1

Gene ID NCBI Gene 29968 |  KEGG hsa:29968
Gene Symbol PSAT1
Protein Name phosphoserine aminotransferase 1
Synonyms EPIP|NLS2|PSA|PSAT|PSATD
Ortholog resources KEGG ortholog (KEGG orthology K00831) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001502 IRAK003M14 pCMV-SPORT6 BC000971 NM_058179 Full
HGX008823 IRAK022A23 pCMV-SPORT6 BC018129 NM_058179 Full
HGX010645 IRAK026K05 pCMV-SPORT6 BC016645 NM_058179 Full/var
HGY085834 IRAL014J18 pOTB7 BC004863 NM_058179 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR247509 ARiS118M21 pGCAP10 NM_021154.3  
GGCAGACTCTCNCCNCNNCGNCCAGGAACGCCAGCCGTTCACGCGTTCGGTCCTCCTTGG
HKR339201 RBb48A01 pGCAP1 NM_021154.3  
GAGACTCTCACCGCAGCGGCCAGGAACGCCAGCCGTTCACGCGTTCGGTCCTCCTTGGCT
HKR373701 RBd34E05 pGCAP10 NM_021154.3  
GAGACTCTCACCGCAGCGGCCAGGAACGCCAGCCGTTCACGCGTTCGGTCCTCCTTGGCT
HKR374852 RBd37C04 pGCAP10 NM_021154.3  
GAGCCGTTCACGCGTTCGGTCCTCCTTGGCTGACTCACCGCCCTCGCCGCCGCACCATGG
HKR405614 RBdS014A14 pGCAP10 NM_021154.3  
GCTCCTTGGCTGACTCACCGCCCTCGCCGCCGCACCATGGACGCCCCCAGGCAGGTGGTC
HKR441866 RBdS104L02 pGCAP10 NM_021154.3  
GAGACTCTCACCGCACCGGCCAGGAACGCCAGCCGTTCACGCGTTCGGTCCTCCTTGGCT
HKR444023 RBdS110A23 pGCAP10 NM_021154.3  
GAGACTCTCACCGCAGCGGCCAGGAACGCCAGCCGTTCACGCGTTCGGTCCTCCTTGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl