Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01090

HP ID(1) HP01090
Gene ID(2) 4709
Gene Symbol finder NDUFB3
Protein Name NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 3, 12kDa
RefSeq NM_002491.2
Length of RefSeq (bp) 770
Chromosome 2q31.3
Reference DDBJ accession
UniGene Hs.109760

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe03G08 pKA1U5 GAGAGTTGAGTGTCCTGAGAGGTCAGATTGCTGTCAGACATGGCCCATGAACATGGACAT
ARi60E09 pGCAP10 TGGCAGAGTTGAGTGTCCTGAGAGGTCAGATTGCTGTCAGACATGGCCCATGAACATGGA
ARiS109F11 pGCAP10 GGAGTGTCCTGAGAGGTCAGATTGCTGTCAGACATGGCCCATGAACATGGACATGAGCAT
ARiS194K01 pGCAP10 GGTCCTGAGAGGTCAGATTGCTGTCAGACATGGCCCATGAACATGGACATGAGCATGGAC
ARiS194P02 pGCAP10 GGGTTGCAGAGTTGAGTGTCCTGAGAGGTCAGATTGCTGTCAGACATGGCCCATGAACAT
RBd49F11 pGCAP10 GGCAGAGTTGAGTGTCCTGAGAGGTCAGATTGCTGTCAGACATGGCCCATGAACATGGAC
RBd71C06 pGCAP10 GGAGTGTCCTGAGAGGTCAGATTGCTGTCAGACATGGCCCATGAACATGGACATGAGCAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl