Prev. |  KEGG KO K03959 > 

RIKEN DNA Bank Human Resource - NDUFB3

Gene ID NCBI Gene 4709 |  KEGG hsa:4709
Gene Symbol NDUFB3
Protein Name NADH:ubiquinone oxidoreductase subunit B3
Synonyms B12|CI-B12
Ortholog resources KEGG ortholog (KEGG orthology K03959) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008713 IRAK021N01 pCMV-SPORT6 BC018183 NM_002491 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041352 ARe03G08 pKA1U5 NM_002491.2  
GAGAGTTGAGTGTCCTGAGAGGTCAGATTGCTGTCAGACATGGCCCATGAACATGGACAT
HKR184105 ARi60E09 pGCAP10 NM_002491.2  
TGGCAGAGTTGAGTGTCCTGAGAGGTCAGATTGCTGTCAGACATGGCCCATGAACATGGA
HKR243731 ARiS109F11 pGCAP10 NM_002491.2  
GGAGTGTCCTGAGAGGTCAGATTGCTGTCAGACATGGCCCATGAACATGGACATGAGCAT
HKR277841 ARiS194K01 pGCAP10 NM_002491.2  
GGTCCTGAGAGGTCAGATTGCTGTCAGACATGGCCCATGAACATGGACATGAGCATGGAC
HKR277962 ARiS194P02 pGCAP10 NM_002491.2  
GGGTTGCAGAGTTGAGTGTCCTGAGAGGTCAGATTGCTGTCAGACATGGCCCATGAACAT
HKR379731 RBd49F11 pGCAP10 NM_002491.2  
GGCAGAGTTGAGTGTCCTGAGAGGTCAGATTGCTGTCAGACATGGCCCATGAACATGGAC
HKR388454 RBd71C06 pGCAP10 NM_002491.2  
GGAGTGTCCTGAGAGGTCAGATTGCTGTCAGACATGGCCCATGAACATGGACATGAGCAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl