Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NDUFB3

Gene ID (NCBI) 4709
Gene Symbol NDUFB3
Protein Name NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 3, 12kDa
Synonyms B12|CI-B12
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX008713 IRAK021N01 pCMV-SPORT6 BC018183 NM_002491 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR041352 ARe03G08 pKA1U5 NM_002491.2
GAGAGTTGAGTGTCCTGAGAGGTCAGATTGCTGTCAGACATGGCCCATGAACATGGACAT
HKR184105 ARi60E09 pGCAP10 NM_002491.2
TGGCAGAGTTGAGTGTCCTGAGAGGTCAGATTGCTGTCAGACATGGCCCATGAACATGGA
HKR243731 ARiS109F11 pGCAP10 NM_002491.2
GGAGTGTCCTGAGAGGTCAGATTGCTGTCAGACATGGCCCATGAACATGGACATGAGCAT
HKR277841 ARiS194K01 pGCAP10 NM_002491.2
GGTCCTGAGAGGTCAGATTGCTGTCAGACATGGCCCATGAACATGGACATGAGCATGGAC
HKR277962 ARiS194P02 pGCAP10 NM_002491.2
GGGTTGCAGAGTTGAGTGTCCTGAGAGGTCAGATTGCTGTCAGACATGGCCCATGAACAT
HKR379731 RBd49F11 pGCAP10 NM_002491.2
GGCAGAGTTGAGTGTCCTGAGAGGTCAGATTGCTGTCAGACATGGCCCATGAACATGGAC
HKR388454 RBd71C06 pGCAP10 NM_002491.2
GGAGTGTCCTGAGAGGTCAGATTGCTGTCAGACATGGCCCATGAACATGGACATGAGCAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.02

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl