Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00993

HP ID(1) HP00993
Gene ID(2) 6902
Gene Symbol finder TBCA
Protein Name tubulin folding cofactor A
RefSeq NM_004607.2
Length of RefSeq (bp) 679
Chromosome 5q14.1
Reference DDBJ accession
UniGene Hs.291212

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe43F01 pKA1U5 GGCCCCTCCTTCTCGCGGCGCTCGAGGGACCANNNNTTNATCCTCGCGTGAGACAGATCA
ARe94G12 pKA1U5 GGCGCAGCCTGCGCATGCGCGCCGGCGACCACGCCTAAATAGCCGCAGCCTCTGCGCGTC
ARf02D01 pKA1U5 GCTAAATAGCCGCAGCCTCTGCGCGTCGCCCTCCACGGNTTACCCCGGCTCTCCGCCCCT
ARi13G02 pGCAP10 GACGGTTACCGCGGCTCTCCGCCCCTCCTTCTCGCGGCGCTCGAGGGACCATGGCCGATC
ARi28F01 pGCAP10 GCTCCTTCTCGCGGCGCTCGAGGGACCATGGCCGATCCTCGCGTGAGACAGATCAAGATC
ARiS008A20 pGCAP10 TAGGCAGCCTCTGCGCGTCGCCCTCCACGGTTACCGCGGCTCTCCGCCCCTCCTTCTCGC
ARiS049A18 pGCAP10 CGGCCGGCCGATGGCATGCGCGCCGGCGACCACGCCTAAATAGCCGCAGCCTCTGCGCGT
ARiS055N23 pGCAP10 GGCAGCCTCTGCGCGTCGCCCTCCACGGTTACCGCGGCTCTCCGCCCCTCCTTCTCGCGG
RBb02F04 pKA1U5 GAGCCTCTGCGCGTCGCCCTCCACGGGTTACCGCNGCTTCTCCGCCCCATCCTTCTCGCG
RBb19A12 pKA1U5 GGCCTAAATAGCCGCAGCCTCTGCGCGTCGCCCTCCACGGNTTACCGCGGCTCTCCGCCC
RBb23B07 pGCAP1 GAGCCGCAGCCTCTGCGCGTCGCCCTCCACGGTTACCCCGGCTCTCCGCCCCTCCTTCTC
RBb27A09 pGCAP1 GGCCCCTCCTTCTCGCGGCGCTCGAGGGACCATGGCCGATCCTCGCGTGAGACAGATCAA
RBb69B01 pGCAP1 GAGCTTCTCGCGGCGCTCGAGGGACCATGGCCGATCCTCGCGTGAGACAGATCAAGATCA
RBd54E04 pGCAP10 GAGACAGATCAAGATCAAGACCGGCGTGGTGAAGCGGTTGGTCAANGAAAAAGTGATGTA
RBd68B09 pGCAP10 GCCCTCCTTCTCGCGGCGCTCGAGGGACCATGGCCGATCCTCGCGTGAGACAGATCAAGA
RBd93B03 pGCAP10 GAGCCTCTGCGCGTCGCCCTCCACGGTTACCCCGGCTCTCCGCCCCTCCTTCTCGCGGCG
RBdS187L16 pGCAP10 AGGTCGCCCTCCACGGTTACCGCGGCTCTCCGCCCCTCCTTCTCGCGGCGCTCGAGGGAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl