Prev. |  KEGG KO K17292 > 

RIKEN DNA Bank Human Resource - TBCA

Gene ID NCBI Gene 6902 |  KEGG hsa:6902
Gene Symbol TBCA
Protein Name tubulin folding cofactor A
Synonyms -
Ortholog resource in our bank

  TBCA

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008539 IRAK021F19 pCMV-SPORT6 BC018210 NM_004607 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR077756 ARe94G12 pKA1U5 NM_004607.2  
GGCGCAGCCTGCGCATGCGCGCCGGCGACCACGCCTAAATAGCCGCAGCCTCTGCGCGTC
HKR080873 ARf02D01 pKA1U5 NM_004607.2  
GCTAAATAGCCGCAGCCTCTGCGCGTCGCCCTCCACGGNTTACCCCGGCTCTCCGCCCCT
HKR165346 ARi13G02 pGCAP10 NM_004607.2  
GACGGTTACCGCGGCTCTCCGCCCCTCCTTCTCGCGGCGCTCGAGGGACCATGGCCGATC
HKR171321 ARi28F01 pGCAP10 NM_004607.2  
GCTCCTTCTCGCGGCGCTCGAGGGACCATGGCCGATCCTCGCGTGAGACAGATCAAGATC
HKR203220 ARiS008A20 pGCAP10 NM_004607.2  
TAGGCAGCCTCTGCGCGTCGCCCTCCACGGTTACCGCGGCTCTCCGCCCCTCCTTCTCGC
HKR219618 ARiS049A18 pGCAP10 NM_004607.2  
CGGCCGGCCGATGGCATGCGCGCCGGCGACCACGCCTAAATAGCCGCAGCCTCTGCGCGT
HKR222335 ARiS055N23 pGCAP10 NM_004607.2  
GGCAGCCTCTGCGCGTCGCCCTCCACGGTTACCGCGGCTCTCCGCCCCTCCTTCTCGCGG
HKR320924 RBb02F04 pKA1U5 NM_004607.2  
GAGCCTCTGCGCGTCGCCCTCCACGGGTTACCGCNGCTTCTCCGCCCCATCCTTCTCGCG
HKR327612 RBb19A12 pKA1U5 NM_004607.2  
GGCCTAAATAGCCGCAGCCTCTGCGCGTCGCCCTCCACGGNTTACCGCGGCTCTCCGCCC
HKR329231 RBb23B07 pGCAP1 NM_004607.2  
GAGCCGCAGCCTCTGCGCGTCGCCCTCCACGGTTACCCCGGCTCTCCGCCCCTCCTTCTC
HKR330809 RBb27A09 pGCAP1 NM_004607.2  
GGCCCCTCCTTCTCGCGGCGCTCGAGGGACCATGGCCGATCCTCGCGTGAGACAGATCAA
HKR347625 RBb69B01 pGCAP1 NM_004607.2  
GAGCTTCTCGCGGCGCTCGAGGGACCATGGCCGATCCTCGCGTGAGACAGATCAAGATCA
HKR381700 RBd54E04 pGCAP10 NM_004607.2  
GAGACAGATCAAGATCAAGACCGGCGTGGTGAAGCGGTTGGTCAANGAAAAAGTGATGTA
HKR387233 RBd68B09 pGCAP10 NM_004607.2  
GCCCTCCTTCTCGCGGCGCTCGAGGGACCATGGCCGATCCTCGCGTGAGACAGATCAAGA
HKR397227 RBd93B03 pGCAP10 NM_004607.2  
GAGCCTCTGCGCGTCGCCCTCCACGGTTACCCCGGCTCTCCGCCCCTCCTTCTCGCGGCG
HKR475080 RBdS187L16 pGCAP10 NM_004607.2  
AGGTCGCCCTCCACGGTTACCGCGGCTCTCCGCCCCTCCTTCTCGCGGCGCTCGAGGGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl