Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00992

HP ID(1) HP00992
Gene ID(2) 11065
Gene Symbol finder UBE2C
Protein Name ubiquitin-conjugating enzyme E2C
RefSeq NM_007019.2
Length of RefSeq (bp) 823
Chromosome 20q13.12
Reference DDBJ accession
UniGene Hs.93002

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe23H09 pKA1U5 GGCAGTTGCAGTCGTGTTCTCCGAGTTCCTGTCTCTCTGCCAACGCCGCCCGGATGGCTT
ARe69D02 pKA1U5 GGCAGTCGTGTTCTCCGAGTTCCTGTCTCTCTGCCAACGCCGCCCGGATGGCTTCCCAAA
ARe89H06 pKA1U5 ATCCTGCTGTCTCTCTGCCAACGCCGCCCGGATGGCTTCCCAAAACCGCGACCCAGCCGC
RBb42G09 pGCAP1 TGGGGCCCGCAGTCCTGCAGTTGCAGTCGTGTTCTCCGAGTTCCTGTCTCTCTGCCAACG
RBb52D11 pGCAP1 GAGTTTGCAGTCGTGTTCTCCGAGTTCCTGTCTCTCTGCCAACGCCGCCCGGATGGCTTC
RBb72D12 pGCAP1 GGCAGTCGTGTTCTCCGAGTTCCTGTCTCTCTGCCAACGCCGCCCGGATGGCTTCCCAAA
RBd14E04 pGCAP10 GAGTTGCAGTCGTGTTCTCCGAGTTCCTGTCTCTCTGCCAACGCCGCCCGGATGGCTTCC
RBd32E10 pGCAP10 GAGTTGCAGTCGTGTTCTCCGAGTTCCTGTCTCTCTGCCAACGCCGCCCGGATGGCTTCC
RBd40A05 pGCAP10 TGAGTTGCAGTCGTGTTCTCCGAGTTCCTGTCTCTCTGCCAACGCCGCCCGGATGGCTTC
RBd43A12 pGCAP10 GGTCTCTCTGCCAACGCCGCCCGGATGGCTTCCCAAAACCGCGACCCAGCCGCCACTAGC
RBd74B10 pGCAP10 GCTGCAGTTGCAGTCGTGTTCTCCGAGTTCCTGTCTCTCTGCCAACGCCGCCCGGATGGC
RBd87A11 pGCAP10 GAGTTGCAGTCGTGTTCTCCGAGTTCCTGTCTCTCTGCCAACGCCGCCCGGATGGCTTCC
RBd87A12 pGCAP10 TGATTTGCCGTCCTGTTTTCGGAGTGAGTGTCTCTCTGCCAACCCCGTTTGGAAGGCTTT
RBd89F03 pGCAP10 GAGTCCTGCAGTTGCAGTCGTGTTCTCCGAGTTCCTGTCTCTCTGCCAACGCCGCCCGGA
RBdS083J14 pGCAP10 GTCTCTGCCAACGCCGCCCGGATGGCTTCCCAAAACCGCGACCCAGCCGCCACTAGCGTC
RBdS154P17 pGCAP10 GAGTCCTGCAGTTGCAGTCGTGTTCTCCGAGTTCCTGTCTCTCTGCCAACGCCGCCCGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl