Prev. |  KEGG KO K06688 > 

RIKEN DNA Bank Human Resource - UBE2C

Gene ID NCBI Gene 11065 |  KEGG hsa:11065
Gene Symbol UBE2C
Protein Name ubiquitin conjugating enzyme E2 C
Synonyms UBCH10|dJ447F3.2
Ortholog resources KEGG ortholog (KEGG orthology K06688) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX006158 IRAK015G14 pCMV-SPORT6 BC016292 NM_181802 Full
HGX025083 IRAK062L19 pCMV-SPORT6 BC028161 NM_181802 Full/var
HGX027933 IRAK069N21 pCMV-SPORT6 BC032677 NM_181803 Partial
HGX044383 IRAK110P23 pCMV-SPORT6 BC050736 NM_181802 Full
HGY082047 IRAL005B23 pOTB7 BC007656 NM_181802 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049377 ARe23H09 pKA1U5 NM_007019.2  
GGCAGTTGCAGTCGTGTTCTCCGAGTTCCTGTCTCTCTGCCAACGCCGCCCGGATGGCTT
HKR067674 ARe69D02 pKA1U5 NM_007019.2  
GGCAGTCGTGTTCTCCGAGTTCCTGTCTCTCTGCCAACGCCGCCCGGATGGCTTCCCAAA
HKR075774 ARe89H06 pKA1U5 NM_007019.2  
ATCCTGCTGTCTCTCTGCCAACGCCGCCCGGATGGCTTCCCAAAACCGCGACCCAGCCGC
HKR336953 RBb42G09 pGCAP1 NM_007019.2  
TGGGGCCCGCAGTCCTGCAGTTGCAGTCGTGTTCTCCGAGTTCCTGTCTCTCTGCCAACG
HKR340883 RBb52D11 pGCAP1 NM_007019.2  
GAGTTTGCAGTCGTGTTCTCCGAGTTCCTGTCTCTCTGCCAACGCCGCCCGGATGGCTTC
HKR348884 RBb72D12 pGCAP1 NM_007019.2  
GGCAGTCGTGTTCTCCGAGTTCCTGTCTCTCTGCCAACGCCGCCCGGATGGCTTCCCAAA
HKR365700 RBd14E04 pGCAP10 NM_007019.2  
GAGTTGCAGTCGTGTTCTCCGAGTTCCTGTCTCTCTGCCAACGCCGCCCGGATGGCTTCC
HKR372906 RBd32E10 pGCAP10 NM_007019.2  
GAGTTGCAGTCGTGTTCTCCGAGTTCCTGTCTCTCTGCCAACGCCGCCCGGATGGCTTCC
HKR376005 RBd40A05 pGCAP10 NM_007019.2  
TGAGTTGCAGTCGTGTTCTCCGAGTTCCTGTCTCTCTGCCAACGCCGCCCGGATGGCTTC
HKR377212 RBd43A12 pGCAP10 NM_007019.2  
GGTCTCTCTGCCAACGCCGCCCGGATGGCTTCCCAAAACCGCGACCCAGCCGCCACTAGC
HKR389634 RBd74B10 pGCAP10 NM_007019.2  
GCTGCAGTTGCAGTCGTGTTCTCCGAGTTCCTGTCTCTCTGCCAACGCCGCCCGGATGGC
HKR394811 RBd87A11 pGCAP10 NM_007019.2  
GAGTTGCAGTCGTGTTCTCCGAGTTCCTGTCTCTCTGCCAACGCCGCCCGGATGGCTTCC
HKR394812 RBd87A12 pGCAP10 NM_007019.2  
TGATTTGCCGTCCTGTTTTCGGAGTGAGTGTCTCTCTGCCAACCCCGTTTGGAAGGCTTT
HKR395723 RBd89F03 pGCAP10 NM_007019.2  
GAGTCCTGCAGTTGCAGTCGTGTTCTCCGAGTTCCTGTCTCTCTGCCAACGCCGCCCGGA
HKR433430 RBdS083J14 pGCAP10 NM_007019.2  
GTCTCTGCCAACGCCGCCCGGATGGCTTCCCAAAACCGCGACCCAGCCGCCACTAGCGTC
HKR461977 RBdS154P17 pGCAP10 NM_007019.2  
GAGTCCTGCAGTTGCAGTCGTGTTCTCCGAGTTCCTGTCTCTCTGCCAACGCCGCCCGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl