Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00990

HP ID(1) HP00990
Gene ID(2) 10204
Gene Symbol finder NUTF2
Protein Name nuclear transport factor 2
RefSeq NM_005796.1
Length of RefSeq (bp) 894
Chromosome 16q22.1
Reference DDBJ accession
UniGene Hs.719219

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe64G09 pKA1U5 GAGAGTGCAGCGGGGCGGGCGAAGGAAGGCAGGGGGGAAGGGACAGTCGGCCGCAGACCG
ARi17D03 pGCAP10 GGCAGACCGCGCTGGGTTGCCGCTGCCGCTGCCGCCATCGTGCCAGCCCCTCGGGTCTCC
ARi39F08 pGCAP10 GGCAGACCGCGCTGGGTTGCCGCTGCCGCTGCCGCCATCGTGCCAGCCCCTCGGGTCTCC
ARiS109O22 pGCAP10 GGAGCCAGCCGGGCGCCTATCTGGGCCGTACCGTGCTGGTGGCTGGTGCACCGGCCTGCG
ARiS118K04 pGCAP10 GGCGCTGGGTTGCCGCTGCCGCTGCCGCCATCGTGCCAGCCCCTCGGGTCTCCGTGAGGC
RBdS075J13 pGCAP10 GGCTGCCGCTGCCGCCATCGTGCCAGCCCCTCGGGTCTCCGTGAGGCCGGGTGACGCTCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl