Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NUTF2

Gene ID (NCBI) 10204
Gene Symbol NUTF2
Protein Name nuclear transport factor 2
Synonyms NTF2|PP15
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY080406 IRAL001A06 pOTB7 BC002348 NM_005796 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE003828 W01A009J12 pENTR-TOPO IRAL001A06 BC002348 NM_005796
HGE003832 W01A009J16 pENTR-TOPO IRAL001A06 BC002348 NM_005796

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR166875 ARi17D03 pGCAP10 NM_005796.1
GGCAGACCGCGCTGGGTTGCCGCTGCCGCTGCCGCCATCGTGCCAGCCCCTCGGGTCTCC
HKR175728 ARi39F08 pGCAP10 NM_005796.1
GGCAGACCGCGCTGGGTTGCCGCTGCCGCTGCCGCCATCGTGCCAGCCCCTCGGGTCTCC
HKR065753 ARe64G09 pKA1U5 NM_005796.1
GAGAGTGCAGCGGGGCGGGCGAAGGAAGGCAGGGGGGAAGGGACAGTCGGCCGCAGACCG
HKR243958 ARiS109O22 pGCAP10 NM_005796.1
GGAGCCAGCCGGGCGCCTATCTGGGCCGTACCGTGCTGGTGGCTGGTGCACCGGCCTGCG
HKR247444 ARiS118K04 pGCAP10 NM_005796.1
GGCGCTGGGTTGCCGCTGCCGCTGCCGCCATCGTGCCAGCCCCTCGGGTCTCCGTGAGGC
HKR430229 RBdS075J13 pGCAP10 NM_005796.1
GGCTGCCGCTGCCGCCATCGTGCCAGCCCCTCGGGTCTCCGTGAGGCCGGGTGACGCTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.04

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl