Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00987

HP ID(1) HP00987
Gene ID(2) 642
Gene Symbol finder BLMH
Protein Name bleomycin hydrolase
RefSeq NM_000386.2
Length of RefSeq (bp) 2417
Chromosome 17q11.2
Reference DDBJ accession
UniGene Hs.371914

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd38H04 pGCAP10 GCGGCGCTCCGGGTGCGAGAGACAGGTCGGGCCCCCTAGGCAGCGAGCCGCAGCGCAATC
RBd40E11 pGCAP10 GAGCCTCCCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGAGCCGGTTTCCTTTTTCCGGCG
RBd86F03 pGCAP10 GACCCCCGCCCCCGCCCCCGCCGATGCGGGTCCCTTCTTGTGTCTCCTCCTCCATCACAG
RBdS156B12 pGCAP10 GGTCCGGCGCTCCGGGTGCGAGAGACAGGTCGGGCCCCCTAGGCAGCGAGCCGCAGCGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl