Prev. |  KEGG KO K01372 > 

RIKEN DNA Bank Human Resource - BLMH

Gene ID NCBI Gene 642 |  KEGG hsa:642
Gene Symbol BLMH
Protein Name bleomycin hydrolase
Synonyms BH|BMH
Ortholog resources KEGG ortholog (KEGG orthology K01372) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081214 IRAL003A14 pOTB7 BC003616 NM_000386 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR375372 RBd38H04 pGCAP10 NM_000386.2  
GCGGCGCTCCGGGTGCGAGAGACAGGTCGGGCCCCCTAGGCAGCGAGCCGCAGCGCAATC
HKR376107 RBd40E11 pGCAP10 NM_000386.2  
GAGCCTCCCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGAGCCGGTTTCCTTTTTCCGGCG
HKR394523 RBd86F03 pGCAP10 NM_000386.2  
GACCCCCGCCCCCGCCCCCGCCGATGCGGGTCCCTTCTTGTGTCTCCTCCTCCATCACAG
HKR462436 RBdS156B12 pGCAP10 NM_000386.2  
GGTCCGGCGCTCCGGGTGCGAGAGACAGGTCGGGCCCCCTAGGCAGCGAGCCGCAGCGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl