Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00983

HP ID(1) HP00983
Gene ID(2) 8775
Gene Symbol finder NAPA
Protein Name N-ethylmaleimide-sensitive factor attachment protein, alpha
RefSeq NM_003827.2
Length of RefSeq (bp) 1846
Chromosome 19q13.32
Reference DDBJ accession
UniGene Hs.719083

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe38D07 pKA1U5 GGAGTTTTACCGATCTGTGTTCCGCGGCCCGGCCGCGGCTGAGTCTTCCCAGGGTCAGGG
ARiS023I08 pGCAP10 GCCTGGCCGCAAGCGACGCGCGCCGGTGCGACGTCAACGCAGCCGGGCGAGTTTTACCGA
ARiS109L16 pGCAP10 GAGTTTTACCGATCTGTGTTCCGCGGCCCGGCCGCGGCTGAGTCTTCCCAGGGTCAGGGT
RBb39A12 pGCAP1 GGAGTTTTACCGATCTGTGTTCCGCGGCCCGGCCGCGGCTGAGTCTTCCCAGGGTCAGGG
RBdS022O23 pGCAP10 GGGTGCGACGTCAACGCAGCCGGGCGAGTTTTACCGATCTGTGTTCCGCGGCCCGGCCGC
RBdS040N13 pGCAP10 GGATCTGTGTTCCGCGGCCCGGCCGCGGCTGAGTCTTCCCAGGGTCAGGGTCAGGCGCTT
RBdS040O21 pGCAP10 TGGCGCGCCGGTGCGACGTCAACGCAGCCGGGCGAGTTTTACCGATCTGTGTTCCGCGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl