Prev. |  KEGG KO K15296 > 

RIKEN DNA Bank Human Resource - NAPA

Gene ID NCBI Gene 8775 |  KEGG hsa:8775
Gene Symbol NAPA
Protein Name NSF attachment protein alpha
Synonyms SNAPA
Ortholog resource in our bank

  NAPA

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025116 IRAK062N04 pCMV-SPORT6 BC028234 NM_003827 Full
HGY083307 IRAL008E11 pOTB7 BC001165 NM_003827 Full
HGY084325 IRAL010N13 pOTB7 BC007432 NM_003827 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE021649 W01A054C01 pENTR-TOPO IRAK062N04 BC028234 NM_003827  
HGE021651 W01A054C03 pENTR-TOPO IRAK062N04 BC028234 NM_003827  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR055279 ARe38D07 pKA1U5 NM_003827.2  
GGAGTTTTACCGATCTGTGTTCCGCGGCCCGGCCGCGGCTGAGTCTTCCCAGGGTCAGGG
HKR209400 ARiS023I08 pGCAP10 NM_003827.2  
GCCTGGCCGCAAGCGACGCGCGCCGGTGCGACGTCAACGCAGCCGGGCGAGTTTTACCGA
HKR243880 ARiS109L16 pGCAP10 NM_003827.2  
GAGTTTTACCGATCTGTGTTCCGCGGCCCGGCCGCGGCTGAGTCTTCCCAGGGTCAGGGT
HKR335612 RBb39A12 pGCAP1 NM_003827.2  
GGAGTTTTACCGATCTGTGTTCCGCGGCCCGGCCGCGGCTGAGTCTTCCCAGGGTCAGGG
HKR409159 RBdS022O23 pGCAP10 NM_003827.2  
GGGTGCGACGTCAACGCAGCCGGGCGAGTTTTACCGATCTGTGTTCCGCGGCCCGGCCGC
HKR416325 RBdS040N13 pGCAP10 NM_003827.2  
GGATCTGTGTTCCGCGGCCCGGCCGCGGCTGAGTCTTCCCAGGGTCAGGGTCAGGCGCTT
HKR416357 RBdS040O21 pGCAP10 NM_003827.2  
TGGCGCGCCGGTGCGACGTCAACGCAGCCGGGCGAGTTTTACCGATCTGTGTTCCGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl