Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NAPA

Gene ID (NCBI) 8775
Gene Symbol NAPA
Protein Name N-ethylmaleimide-sensitive factor attachment protein, alpha
Synonyms SNAPA
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K15296)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX025116 IRAK062N04 pCMV-SPORT6 BC028234 NM_003827 Full
HGY083307 IRAL008E11 pOTB7 BC001165 NM_003827 Full
HGY084325 IRAL010N13 pOTB7 BC007432 NM_003827 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE021649 W01A054C01 pENTR-TOPO IRAK062N04 BC028234 NM_003827  
HGE021651 W01A054C03 pENTR-TOPO IRAK062N04 BC028234 NM_003827  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR055279 ARe38D07 pKA1U5 NM_003827.2  
GGAGTTTTACCGATCTGTGTTCCGCGGCCCGGCCGCGGCTGAGTCTTCCCAGGGTCAGGG
HKR209400 ARiS023I08 pGCAP10 NM_003827.2  
GCCTGGCCGCAAGCGACGCGCGCCGGTGCGACGTCAACGCAGCCGGGCGAGTTTTACCGA
HKR243880 ARiS109L16 pGCAP10 NM_003827.2  
GAGTTTTACCGATCTGTGTTCCGCGGCCCGGCCGCGGCTGAGTCTTCCCAGGGTCAGGGT
HKR335612 RBb39A12 pGCAP1 NM_003827.2  
GGAGTTTTACCGATCTGTGTTCCGCGGCCCGGCCGCGGCTGAGTCTTCCCAGGGTCAGGG
HKR409159 RBdS022O23 pGCAP10 NM_003827.2  
GGGTGCGACGTCAACGCAGCCGGGCGAGTTTTACCGATCTGTGTTCCGCGGCCCGGCCGC
HKR416325 RBdS040N13 pGCAP10 NM_003827.2  
GGATCTGTGTTCCGCGGCCCGGCCGCGGCTGAGTCTTCCCAGGGTCAGGGTCAGGCGCTT
HKR416357 RBdS040O21 pGCAP10 NM_003827.2  
TGGCGCGCCGGTGCGACGTCAACGCAGCCGGGCGAGTTTTACCGATCTGTGTTCCGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.06.01

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl