Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00971

HP ID(1) HP00971
Gene ID(2) 5589
Gene Symbol finder PRKCSH
Protein Name protein kinase C substrate 80K-H
RefSeq NM_002743.2
Length of RefSeq (bp) 2262
Chromosome 19p13.2
Reference DDBJ accession
UniGene Hs.610830

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe04G03 pKA1U5 GCCGCTTTCTTTCTGCAGCAGGAACCGCGGCTGCNTGGACAAGAGGGGTGCGGTGGATAC
ARe82E12 pKA1U5 ATCCTGCNGAAATTTCCGCTTTCTTTCTGCAGGCANNCAACCGANGGCTGCTGGACAAGA
ARi41E12 pGCAP10 CTTTCTGCAGCAGGAACCGCGGCTGCTGGACAAGAGGGGTGCGGTGGATACTGACCTTTG
ARi44B10 pGCAP10 GGCTTTCTTTCTGCAGCAGGAACCGCGGCTGCTGGACAAGAGGGGTGCGGTGGATACTGA
ARiS150P05 pGCAP10 GGGACNNNNNNNNTGCNGTGNATACTGACCTTTGCNCCGGCCTCGTCGTGAAGACACAGC
RBdS075H14 pGCAP10 GGCAGCAGGAACCGCGGCTGCTGGACAAGAGGGGTGCGGTGGATACTGACCTTTGCTCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl