Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - PRKCSH

Gene ID (NCBI) 5589
Gene Symbol PRKCSH
Protein Name protein kinase C substrate 80K-H
Synonyms AGE-R2|G19P1|PCLD|PKCSH|PLD1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX005737 IRAK014F17 pCMV-SPORT6 BC013586 NM_002743 Partial/var
HGX008812 IRAK022A12 pCMV-SPORT6 BC015154 NM_001001329 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE014908 W01A037E12 pENTR-TOPO IRAK014F17 BC013586 NM_002743  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041747 ARe04G03 pKA1U5 NM_002743.2  
GCCGCTTTCTTTCTGCAGCAGGAACCGCGGCTGCNTGGACAAGAGGGGTGCGGTGGATAC
HKR176508 ARi41E12 pGCAP10 NM_002743.2  
CTTTCTGCAGCAGGAACCGCGGCTGCTGGACAAGAGGGGTGCGGTGGATACTGACCTTTG
HKR177634 ARi44B10 pGCAP10 NM_002743.2  
GGCTTTCTTTCTGCAGCAGGAACCGCGGCTGCTGGACAAGAGGGGTGCGGTGGATACTGA
HKR072908 ARe82E12 pKA1U5 NM_002743.2  
ATCCTGCNGAAATTTCCGCTTTCTTTCTGCAGGCANNCAACCGANGGCTGCTGGACAAGA
HKR260365 ARiS150P05 pGCAP10 NM_002743.2  
GGGACNNNNNNNNTGCNGTGNATACTGACCTTTGCNCCGGCCTCGTCGTGAAGACACAGC
HKR430182 RBdS075H14 pGCAP10 NM_002743.2  
GGCAGCAGGAACCGCGGCTGCTGGACAAGAGGGGTGCGGTGGATACTGACCTTTGCTCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.12.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl