Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00959

HP ID(1) HP00959
Gene ID(2) 7298
Gene Symbol finder TYMS
Protein Name thymidylate synthase
RefSeq NM_001071.2
Length of RefSeq (bp) 1603
Chromosome 18p11.32
Reference DDBJ accession
UniGene Hs.592338

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe67H11 pKA1U5 ATCCTGTGACTTCGCCTGCCTCCGTCCCCCGCCCGCCGCGCCATGCCTGTGGCCGGCTCG
ARe70E02 pKA1U5 GGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCCGCCCGCCGCGCCAT
ARi16F04 pGCAP10 TTGGCGGAAGGGGTCCTGCCACCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTT
RBb14E03 pKA1U5
RBb17E03 pKA1U5 ATCCTGGGCCTGCCTCCGTCCCGCCGCGCCACTTTTNCTGCCTCCGTCCCGCCGCGCCAC
RBb25E08 pGCAP1 GCCACTTGGCCTGCCTCCGNTCCCGCCGCGCCACTTCGCCTGCCTCCGATCCCGCCGCGC
RBb63H05 pGCAP1 ACTTCGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCCGCCCGCCGCG
RBd12D01 pGCAP10 GGCGGGACGGCCGCGGGAAAAGGCGCGCGGAAGGGGTCCTGCCACCGCGCCACTTGGCCT
RBd27C10 pGCAP10 GGCGCGGGACGGCCGCGGGAAAAGGCGCGCGGAAGGGGTCCTGCCACCGCGCCACTTGGC
RBd57E10 pGCAP10 GGGAAGGGGTCCTGCCACCGCGCCACTTGGCCTGCCTCCGTCCNNNNNCGCCACTTCGCC
RBd64E07 pGCAP10 GGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCGCCGCGCC
RBd71E08 pGCAP10 GAGCGCGGGACGGCCGCGGGAAAAGGCGCGCGGAAGGGGTCCTGCCACCGCGCCACTTGG
RBdS014F06 pGCAP10 GGCCACCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCC
RBdS083O24 pGCAP10 GGGGAAAAGGCGCGCGGAAGGGGTCCTGCCACCGCGCCACTTGGCCTGCCTCCGTCCCGC
RBdS154P24 pGCAP10 GGAGCGCGGGACGGCCGCGGGAAAAGGCGCGCGGAAGGGGTCCTGCCACCGCGCCACTTG
RBdS177K01 pGCAP10 GGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCGCCGCGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl