Prev. |  KEGG KO K00560 > 

RIKEN DNA Bank Human Resource - TYMS

Gene ID NCBI Gene 7298 |  KEGG hsa:7298
Gene Symbol TYMS
Protein Name thymidylate synthetase
Synonyms HST422|TMS|TS
Ortholog resource in our bank

  TYMS

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081979 IRAL004P19 pOTB7 BC002567 NM_001071 Full
HGY092740 IRAL031O04 pDNR-LIB BC013919 NM_001071 Full
HGY103234 IRAL058B10 pOTB7 BC083512 NM_001071 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR066979 ARe67H11 pKA1U5 NM_001071.2  
ATCCTGTGACTTCGCCTGCCTCCGTCCCCCGCCCGCCGCGCCATGCCTGTGGCCGGCTCG
HKR068098 ARe70E02 pKA1U5 NM_001071.2  
GGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCCGCCCGCCGCGCCAT
HKR166524 ARi16F04 pGCAP10 NM_001071.2  
TTGGCGGAAGGGGTCCTGCCACCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTT
HKR325699 RBb14E03 pKA1U5 NM_001071.2  
HKR326899 RBb17E03 pKA1U5 NM_001071.2  
ATCCTGGGCCTGCCTCCGTCCCGCCGCGCCACTTTTNCTGCCTCCGTCCCGCCGCGCCAC
HKR330104 RBb25E08 pGCAP1 NM_001071.2  
GCCACTTGGCCTGCCTCCGNTCCCGCCGCGCCACTTCGCCTGCCTCCGATCCCGCCGCGC
HKR345373 RBb63H05 pGCAP1 NM_001071.2  
ACTTCGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCCGCCCGCCGCG
HKR364873 RBd12D01 pGCAP10 NM_001071.2  
GGCGGGACGGCCGCGGGAAAAGGCGCGCGGAAGGGGTCCTGCCACCGCGCCACTTGGCCT
HKR370858 RBd27C10 pGCAP10 NM_001071.2  
GGCGCGGGACGGCCGCGGGAAAAGGCGCGCGGAAGGGGTCCTGCCACCGCGCCACTTGGC
HKR382906 RBd57E10 pGCAP10 NM_001071.2  
GGGAAGGGGTCCTGCCACCGCGCCACTTGGCCTGCCTCCGTCCNNNNNCGCCACTTCGCC
HKR385703 RBd64E07 pGCAP10 NM_001071.2  
GGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCGCCGCGCC
HKR388504 RBd71E08 pGCAP10 NM_001071.2  
GAGCGCGGGACGGCCGCGGGAAAAGGCGCGCGGAAGGGGTCCTGCCACCGCGCCACTTGG
HKR405726 RBdS014F06 pGCAP10 NM_001071.2  
GGCCACCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCC
HKR433560 RBdS083O24 pGCAP10 NM_001071.2  
GGGGAAAAGGCGCGCGGAAGGGGTCCTGCCACCGCGCCACTTGGCCTGCCTCCGTCCCGC
HKR461984 RBdS154P24 pGCAP10 NM_001071.2  
GGAGCGCGGGACGGCCGCGGGAAAAGGCGCGCGGAAGGGGTCCTGCCACCGCGCCACTTG
HKR471041 RBdS177K01 pGCAP10 NM_001071.2  
GGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCGCCGCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl