Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00950

HP ID(1) HP00950
Gene ID(2) 7320
Gene Symbol finder UBE2B
Protein Name ubiquitin-conjugating enzyme E2B (RAD6 homolog)
RefSeq NM_003337.2
Length of RefSeq (bp) 2631
Chromosome 5q23-q31
Reference DDBJ accession
UniGene Hs.644421

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe57E07 pKA1U5 TAAGTCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGATCCACAGTGATTCGGCCGCCGC
ARe68A01 pKA1U5 TAAGTCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGATCCACAGNTGATTCGGCCGCCG
ARi40G11 pGCAP10 GGGCGGCGGCGGCGGCGGCGGCGGCGGCGATCCACAGTGATTCGGCCGCCGCGCCGGGGG
RBd16C09 pGCAP10 GGTCAGTCTCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGATCCACAGTGATTCGGCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl