Prev. |  KEGG KO K10574 > 

RIKEN DNA Bank Human Resource - UBE2B

Gene ID NCBI Gene 7320 |  KEGG hsa:7320
Gene Symbol UBE2B
Protein Name ubiquitin conjugating enzyme E2 B
Synonyms E2-17kDa|HHR6B|HR6B|RAD6B|UBC2
Ortholog resources KEGG ortholog (KEGG orthology K10574) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081465 IRAL003L01 pOTB7 BC001694 NM_003337 Partial/var
HGY088533 IRAL021F13 pDNR-LIB BC005979 NM_003337 Full
HGY088662 IRAL021K22 pDNR-LIB BC008404 NM_003337 Full
HGY088712 IRAL021M24 pDNR-LIB BC008470 NM_003337 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE013457 W01A033K17 pENTR-TOPO IRAL021F13 BC005979 NM_003337  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR062903 ARe57E07 pKA1U5 NM_003337.2  
TAAGTCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGATCCACAGTGATTCGGCCGCCGC
HKR067201 ARe68A01 pKA1U5 NM_003337.2  
TAAGTCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGATCCACAGNTGATTCGGCCGCCG
HKR176155 ARi40G11 pGCAP10 NM_003337.2  
GGGCGGCGGCGGCGGCGGCGGCGGCGGCGATCCACAGTGATTCGGCCGCCGCGCCGGGGG
HKR366457 RBd16C09 pGCAP10 NM_003337.2  
GGTCAGTCTCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGATCCACAGTGATTCGGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl