Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00918

HP ID(1) HP00918
Gene ID(2) 11331
Gene Symbol finder PHB2
Protein Name prohibitin 2
RefSeq NM_007273.3
Length of RefSeq (bp) 1416
Chromosome 12p13
Reference DDBJ accession
UniGene Hs.504620

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe37B03 pKA1U5 GACGGGCCCGAACCCTCGTGTGAAGGGTGCAGCTACCTAAGCCGGAGCGGGGTAGAGGCG
ARe38H04 pKA1U5 GCTTTTTTTCGCCAGCCTTACGGGCCCGAACCCTCTTGTGAAGGGTGCAGTACCTAAGCC
ARe88E12 pKA1U5 GCCTTTCTTTCGCCAGCCTTACGGGCCCGAACCCTCGTGTGAAGGGTGCAGTACCTAAGC
RBb50D07 pGCAP1 GAGCGCACTTCCGCTGCCCTTTCTTTCGCCAGCCTTACGGGCCCNAACCCTCGTTGTGAA
RBb53H02 pGCAP1 GGGGAGCGCACATTCCGCATGCCCTTTCTTTCGCCAGCCTTACGGGCCCGAACCCTCGTG
RBd28C06 pGCAP10 GACGGGCCCGAACCCTCGTGTGAAGGGTGCAGTACCTAAGCCGGAGCGGGGTAGAGGCGG
RBd53G05 pGCAP10 GACGGGCCCGAACCCTCGTGTGAAGGGTGCAGTACCTAAGCCGGAGCGGGGTAGAGGCGG
RBd87B07 pGCAP10 CTTTTCGCCAGCCTTACGGGCCCGAACCCTCGTGTGAAGGGTGCAGTACCTAAGCCGGAG
RBdS013D21 pGCAP10 GAGCCTTACGGGCCCGAACCCTCGTGTGAAGGGTGCAGTACCTAAGCCGGAGCGGGGTAG
RBdS081A03 pGCAP10 GACGGGCCCGAACCCTCGTGTGAAGGGTGCAGTACCTAAGCCGGAGCGGGGTAGAGGCGG
RBdS156B13 pGCAP10 GCTTTCTTTCGCCAGCCTTACGGGCCCGAACCCTCGTGTGAAGGGTGCAGTACCTAAGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl