Prev. |  KEGG KO K17081 > 

RIKEN DNA Bank Human Resource - PHB2

Gene ID NCBI Gene 11331 |  KEGG hsa:11331
Gene Symbol PHB2
Protein Name prohibitin 2
Synonyms BAP|BCAP37|Bap37|PNAS-141|REA|hBAP|p22
Ortholog resources KEGG ortholog (KEGG orthology K17081) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX007859 IRAK019K19 pCMV-SPORT6 BC014766 NM_007273 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE001114 W01A002N02 pENTR-TOPO IRAK019K19 BC014766 NM_007273  
HGE001118 W01A002N06 pENTR-TOPO IRAK019K19 BC014766 NM_007273  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR054827 ARe37B03 pKA1U5 NM_007273.3  
GACGGGCCCGAACCCTCGTGTGAAGGGTGCAGCTACCTAAGCCGGAGCGGGGTAGAGGCG
HKR055372 ARe38H04 pKA1U5 NM_007273.3  
GCTTTTTTTCGCCAGCCTTACGGGCCCGAACCCTCTTGTGAAGGGTGCAGTACCTAAGCC
HKR075308 ARe88E12 pKA1U5 NM_007273.3  
GCCTTTCTTTCGCCAGCCTTACGGGCCCGAACCCTCGTGTGAAGGGTGCAGTACCTAAGC
HKR340079 RBb50D07 pGCAP1 NM_007273.3  
GAGCGCACTTCCGCTGCCCTTTCTTTCGCCAGCCTTACGGGCCCNAACCCTCGTTGTGAA
HKR341370 RBb53H02 pGCAP1 NM_007273.3  
GGGGAGCGCACATTCCGCATGCCCTTTCTTTCGCCAGCCTTACGGGCCCGAACCCTCGTG
HKR371254 RBd28C06 pGCAP10 NM_007273.3  
GACGGGCCCGAACCCTCGTGTGAAGGGTGCAGTACCTAAGCCGGAGCGGGGTAGAGGCGG
HKR381349 RBd53G05 pGCAP10 NM_007273.3  
GACGGGCCCGAACCCTCGTGTGAAGGGTGCAGTACCTAAGCCGGAGCGGGGTAGAGGCGG
HKR394831 RBd87B07 pGCAP10 NM_007273.3  
CTTTTCGCCAGCCTTACGGGCCCGAACCCTCGTGTGAAGGGTGCAGTACCTAAGCCGGAG
HKR405293 RBdS013D21 pGCAP10 NM_007273.3  
GAGCCTTACGGGCCCGAACCCTCGTGTGAAGGGTGCAGTACCTAAGCCGGAGCGGGGTAG
HKR432403 RBdS081A03 pGCAP10 NM_007273.3  
GACGGGCCCGAACCCTCGTGTGAAGGGTGCAGTACCTAAGCCGGAGCGGGGTAGAGGCGG
HKR462437 RBdS156B13 pGCAP10 NM_007273.3  
GCTTTCTTTCGCCAGCCTTACGGGCCCGAACCCTCGTGTGAAGGGTGCAGTACCTAAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl