Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00865

HP ID(1) HP00865
Gene ID(2) 10102
Gene Symbol finder TSFM
Protein Name Ts translation elongation factor, mitochondrial
RefSeq NM_005726.4
Length of RefSeq (bp) 2046
Chromosome 12q13-q14
Reference DDBJ accession
UniGene Hs.632704

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi15B07 pGCAP10 GGCGGCTAGAGAGATGTCGCTGCTGCGGTCGCTGCGCGTGTTTCTGGTCGCGCGGACCGG
RBd99H11 pGCAP10 GATCGCGGCTAGAGAGATGTCGCTGCTGCGGTCGCTGCGCGTGTTTCTGGTCGCGCGGAC
RBdS007D09 pGCAP10 GGCCGGAGGGTGTTTATCGCGGCTAGAGAGATGTCGCTGCTGCGGTCGCTGCGCGTGTTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl