Prev. |  KEGG KO K02357 > 

RIKEN DNA Bank Human Resource - TSFM

Gene ID NCBI Gene 10102 |  KEGG hsa:10102
Gene Symbol TSFM
Protein Name Ts translation elongation factor, mitochondrial
Synonyms EFTS|EFTSMT
Ortholog resource in our bank

  TSFM

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY093073 IRAL032L09 pDNR-LIB BC022862 NM_005726 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR166031 ARi15B07 pGCAP10 NM_005726.4  
GGCGGCTAGAGAGATGTCGCTGCTGCGGTCGCTGCGCGTGTTTCTGGTCGCGCGGACCGG
HKR399779 RBd99H11 pGCAP10 NM_005726.4  
GATCGCGGCTAGAGAGATGTCGCTGCTGCGGTCGCTGCGCGTGTTTCTGGTCGCGCGGAC
HKR402881 RBdS007D09 pGCAP10 NM_005726.4  
GGCCGGAGGGTGTTTATCGCGGCTAGAGAGATGTCGCTGCTGCGGTCGCTGCGCGTGTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl