Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00790

HP ID(1) HP00790
Gene ID(2) 3735
Gene Symbol finder KARS
Protein Name lysyl-tRNA synthetase
RefSeq NM_005548.2
Length of RefSeq (bp) 2017
Chromosome 16q23-q24
Reference DDBJ accession
UniGene Hs.3100

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi42H02 pGCAP10 GGGGCCCTCCGGGAAGATGGCGGCCGTGCAGGCGGCCGAGGTGAAAGTGGATGGCAGCGA
ARiS118O14 pGCAP10 GGGGCCCTCCGGGAAGATGGCGGCCGTGCAGGCGGCCGAGGTGAAAGTGGATGGCAGCGA
RBb19F09 pKA1U5 GGGGCCCTCCGGGAAGATGGCGGCCGTGCAGGCGGCCGAGGTGAAAGTGGATGGCAGCGA
RBb43A09 pGCAP1 ACTTTTGGGTCGGGCCCTCCGGGAAGATGGCGGCCGTGCCNCTANNNGAGGTGAAAGT
RBd04D01 pGCAP10 GACTTTTGGGTCGGGCCCTCCGGGAAGATGGCGGCCGTGCAGGCGGCCGAGGTGAAAGTG
RBd24E03 pGCAP10 GACTTTTGGGTCGGGCCCTCCGGGAAGATGGCGGCCGTGCAGGCGGCCGAGGTGAAAGTG
RBd48H11 pGCAP10 GACTTTTGGGTCGGGCCCTCCGGGAAGATGGCGGCCGTGCAGGCGGCCGAGGTGAAAGTG
RBd63A11 pGCAP10 GACTTTTGGGTCGGGCCCTCCGGGAAGATGGCGGCCGTGCAGGCGGCCGAGGTGAAAGTG
RBd63A12 pGCAP10 GGCTTTTGGGCCGGGCCCTCCGGGAAGATGGTGGCCGTGCTGGCGGCCGAGCTGCAAGNC
RBd77H01 pGCAP10 GCCCTCCGGGAAGATGGCGGCCGTGCAGGCGGCCGAGGTGAAAGTGGATGGCAGCGAGCC
RBdS154I11 pGCAP10 GACTTTTGGGTCGGGCCCTCCGGGAAGATGGCGGCCGTGCAGGCGGCCGAGGTGAAAGTG
RBdS156C08 pGCAP10 GACTTTTGGGTCGGGCCCTCCGGGAAGATGGCGGCCGTGCAGGCGGCCGAGGTGAAAGTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl