Prev. |  KEGG KO K04567 > 

RIKEN DNA Bank Human Resource - KARS

Gene ID NCBI Gene 3735 |  KEGG hsa:3735
Gene Symbol KARS
Protein Name lysyl-tRNA synthetase
Synonyms CMTRIB|DFNB89|KARS1|KARS2|KRS
Ortholog resources KEGG ortholog (KEGG orthology K04567) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081078 IRAL002L14 pOTB7 BC004132 NM_005548 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR176970 ARi42H02 pGCAP10 NM_005548.2  
GGGGCCCTCCGGGAAGATGGCGGCCGTGCAGGCGGCCGAGGTGAAAGTGGATGGCAGCGA
HKR247550 ARiS118O14 pGCAP10 NM_005548.2  
GGGGCCCTCCGGGAAGATGGCGGCCGTGCAGGCGGCCGAGGTGAAAGTGGATGGCAGCGA
HKR327729 RBb19F09 pKA1U5 NM_005548.2  
GGGGCCCTCCGGGAAGATGGCGGCCGTGCAGGCGGCCGAGGTGAAAGTGGATGGCAGCGA
HKR337209 RBb43A09 pGCAP1 NM_005548.2  
ACTTTTGGGTCGGGCCCTCCGGGAAGATGGCGGCCGTGCCNCTANNNGAGGTGAAAGT
HKR361673 RBd04D01 pGCAP10 NM_005548.2  
GACTTTTGGGTCGGGCCCTCCGGGAAGATGGCGGCCGTGCAGGCGGCCGAGGTGAAAGTG
HKR369699 RBd24E03 pGCAP10 NM_005548.2  
GACTTTTGGGTCGGGCCCTCCGGGAAGATGGCGGCCGTGCAGGCGGCCGAGGTGAAAGTG
HKR379379 RBd48H11 pGCAP10 NM_005548.2  
GACTTTTGGGTCGGGCCCTCCGGGAAGATGGCGGCCGTGCAGGCGGCCGAGGTGAAAGTG
HKR385211 RBd63A11 pGCAP10 NM_005548.2  
GACTTTTGGGTCGGGCCCTCCGGGAAGATGGCGGCCGTGCAGGCGGCCGAGGTGAAAGTG
HKR385212 RBd63A12 pGCAP10 NM_005548.2  
GGCTTTTGGGCCGGGCCCTCCGGGAAGATGGTGGCCGTGCTGGCGGCCGAGCTGCAAGNC
HKR390969 RBd77H01 pGCAP10 NM_005548.2  
GCCCTCCGGGAAGATGGCGGCCGTGCAGGCGGCCGAGGTGAAAGTGGATGGCAGCGAGCC
HKR461803 RBdS154I11 pGCAP10 NM_005548.2  
GACTTTTGGGTCGGGCCCTCCGGGAAGATGGCGGCCGTGCAGGCGGCCGAGGTGAAAGTG
HKR462456 RBdS156C08 pGCAP10 NM_005548.2  
GACTTTTGGGTCGGGCCCTCCGGGAAGATGGCGGCCGTGCAGGCGGCCGAGGTGAAAGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl